Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Obecná lingvistika ( magisterské navazující dvouoborové studium prezenční ) ‏ Obecná lingvistika a teorie komunikace (magisterské navazující jednooborové.

Podobné prezentace


Prezentace na téma: "Obecná lingvistika ( magisterské navazující dvouoborové studium prezenční ) ‏ Obecná lingvistika a teorie komunikace (magisterské navazující jednooborové."— Transkript prezentace:

1

2 Obecná lingvistika ( magisterské navazující dvouoborové studium prezenční ) ‏ Obecná lingvistika a teorie komunikace (magisterské navazující jednooborové studium prezenční) ‏ Studium obecné lingvistiky a teorie komunikace na KB FF UP Katedra bohemistiky nabízí od akademického roku 2009/2010 tyto studijní programy

3 Osmnáctiletý plochodrážní jezdec Matěj Kůs z Plzně si prošel něčím velmi neobvyklým. Během nedělního závodu svého týmu Berwick Bandits mu ve Skotsku jeden ze soupeřů přejel hlavu a on utrpěl vážná zranění. Jakmile se jezdec s přezdívkou KusKus probral z bezvědomí, mluvil prý několik hodin dokonale anglicky bez cizího přízvuku. Sám přitom přiznává, že jsou chvíle, kdy je rád, že vůbec anglicky rozumí. zdroj: Novinky.cz Odpověď v kurzu Neurolingvistika

4 Studijní programy jsou určeny pro: Absolventy bakalářských filologických programů Obecná lingvistika je vhodným oborem dvojkombinace pro studenty, kteří chtějí rozšiřovat teoretickou/konceptuální bázi svého lingvistického vzdělání, aby ji mohli využít v druhém oboru své dvojkombinace. Jednooborové studium může student volit, jestliže se v dosavadním průběhu svého studia orientoval ve směru teorie jazyka. Absolventy dalších humanitních oborů Pro všechny humanitně zaměřené studenty, kteří ve svém předchozím studiu tendovali k řešení problémů komunikace a jazyka, je obecná lingvistika v jednooborové i dvouoborové variantě možností, jak pokračovat ve studiu bez zaměření na konkrétní filologickou tradici v plném jejím rozsahu, včetně literárněvědných kontextů, a zaměřovat se na teoretické otázky. Absolventy přírodovědných oborů Těm z absolventů přírodovědných oborů, kteří chtějí své další studium a výzkum v interdisciplinárním kontaktu provázat s lingvistikou, je zde umožněno obecně lingvistikou problematiku poznávat od základů; studijní program však především umožňuje specializaci v některé z pomezních lingvistických disciplín související s bakalářským, případně magisterským studiem daného uchazeče. Oba studijní programy jsou nabízeny právě těm, kdo se chtějí rozvíjet čistě obecně lingvistickým směrem, a to v kontaktu s osobnostmi, které u nás současnou obecnou lingvistiku významně reprezentují a které odborně zajišťují výzkum v jednotlivých oblastech obecné lingvistiky.

5 Když je ukládán radioaktivní odpad, vyvstává problém, jak upozornit na nebezpečí radiace: anglicky, protože je angličtina mezinárodní jazyk, nebo zavedeným symbolem? Jak zaručit, že potenciální čtenář za deset tisíc let nebo později porozumí sdělení? Jakou znakovou soustavu a jaké znaky zvolit, jakých univerzálií komunikace – pokud existují – se přidržovat? Řešení tohoto problému obecní lingvisté – například Thomas A. Sebeok – už hledali. Odpověď můžete hledat v našem studijním programu – v kurzu Sémiotika.

6 Studium v obou programech je rozděleno na dvě stejně závažné části Předměty povinného základu Předměty volitelné Student tedy absolvuje kurzy, které jej profilují jako obecného lingvistu, zároveň si však musí zvolit specializaci, v jejímž okruhu bude vybírat z nabízených povinně volitelných předmětů. Státní zkouška z obou oborů pak sestává z části obecně lingvistické a z části dané studentem zvolenou specializací.

7 Biologové tvrdí, že DNA je série značek, které jsou přepisovány do jiné znakové sady, do RNA, a později překládány do podoby bílkovin. Tyto operace jsou možné díky syntaktickým značkám, které určují, kde má přepisování začít a skončit, které části řetězce na sebe mají navazovat. V DNA i RNA se řetězce skládají ze čtyř bází, které jsou označovány prvními písmeny svých jmen, a ty v trojkombinaci s dalšími dvěma rozlišují, jaká bude po překladu vytvořena aminokyselina. Sled konkrétních aminokyselin tvoří konkrétní bílkovinu se specifickými vlastnostmi. Jako by tyto jednotky, báze, triplet a gen, měly stejnou funkci jako hláska, slovo a věta. gcccctgcccttgaaatggcccttgaatgagcccctgccctgaaatgg cccttgaatgagcccctgcccttgaaatggcccttgaatgagcccctg cccttgaaatggcccttgaatgagcccctgcccttgaaatggcccttg aatgagcccctgcccttgaaatggcccttgaatgagcccctgcccttg aaatggcccttgaatgagcccctgcccttgaaatggcccttgaatgag cccctgcccttgaaatggcccttgaatga gcccctgcccttgaaatgg Je tedy DNA text? Nebo je to dokonce jazyk? Když je mezi DNA a přirozeným jazykem tolik podobností, nemůže být DNA prvotním jazykem, na jehož základě se přirozený jazyk vyvinul? A nebo je život prostě znakový proces? Odpovědi na tyto otázky naleznete v kurzu Metodologie lingvistiky.

8 Předměty povinného základu V předmětech označených jako základní si absolvent osvojí znalosti a kompetence, které mu poskytnou široký rámec vědění vázaný na obecnou problematiku jazyka a řeči. Charakter těchto disciplín zajistí, aby se absolvent dostatečně orientoval: v elementárních pravidlech vědního poznávání, výstavby teorie, falzifikace hypotézy, modelačních mohutnostech jednotlivých lingvistických přístupů, jejich schopnosti popisovat vybrané aspekty komunikace či jazyka (Metody lingvistiky, Obecná lingvistika, Filozofie a jazyk)‏ v současném stavu obecné lingvistiky a jejích specifických přístupech k předmětu poznávání, konfrontačně pak se zaměřením na jednotlivé školy, tradice či disciplíny; část výuky je koncipována jako přednáškový cyklus hostujících odborníků různého zaměření, jejichž podíl na výuce bude nejen aktualizovat informace z jejich oborů, ale především jsou vybíráni jako autority v dané oblasti (Obecná lingvistika, Současné přístupy ke komunikaci a jazyku, Sémiotika)‏ v historii věd o řeči (Proměny myšlení o komunikaci a jazyku, Filozofie a jazyk). Při studiu bude kladen důraz na analytické dovednosti, aby byl absolvent schopen získané poznatky aplikovat v rovině konkrétních specifických výzkumů, a aby je mohl ověřovat na vybraných textech. (Komplexní analýza komunikačního procesu a textu).

9 Vezmeme dílo libovolného autora, spočítáme kolikrát se v něm všechna slova vyskytují a sestavíme jejich seznam od nejfrekventovanějšího až k těm, která se vyskytují jen jednou. Pak přidělíme slovům pořadová čísla, nejvíce frekventovanému 1, dalšímu 2 atd. Když teď vynásobíme pořadové číslo například šestistého slova v naší řadě s jeho frekvencí, počtem oněch výskytů v autorově díle, vyjde nám určité x. Když stejnou operaci provedeme s pětistým slovem, s tisícím a třistatřiatřicátým, budou nám vycházet hodnoty blízké onomu x. Což pak musí znamenat, že to, kolikrát se různá slova objeví v našich textech, podléhá přísnému zákonu, že nám cosi diktuje frekvenční proporcionalitu používaných slov. Jakým dalším matematickým zákonitostem podléhají vaše texty, se dozvíte v našem kurzu Matematická lingvistika.

10 Navržené kombinace povinně volitelných předmětů Metodologická (Filozofie a jazyk, Sémiotika, Možnosti gramatiky, Teorie významu: přístupy a metody)‏ Věnovaná vybraným lingvistickým přístupům (Generativní gramatika, Korpusová lingvistika, Jazyky a jejich zvuky, Jazyková typologie)‏ Matematizující (Základy matematiky pro lingvisty, Matematika a lingvistika, Možnosti matematického modelování textu)‏ Kognitivní (Psycholingvistika, Neurolingvistika, Jazyk a kognice)‏ Historizující (Pražský strukturalismus, Proměny českého lingvistického myšlení, Četba lingvistického textu)‏ Komunikační (Teorie textu, Sociolingvistika, Pragmatické aspekty jazyka)‏

11 Když mluvíme, běžně předpokládáme, že naše slova mají nějaký význam. Věříme, že právě proto nám lidé v našem okolí rozumí. Jen občas někdo prohodí: „Je mi jedno, co jsi tím myslel, důležité je, co jsi řekl.“ Co je to tedy význam slova? Jak k němu naše slova přišla? Kde máme významy hledat? Máme významy v hlavě? Poletují někde v nebi plném idejí? Nesou si slova významy s sebou, nebo významy vždy znova a znova vznikají v komunikaci? Může věta „Tamhleten strom je olše“ znamenat JSEM VDANÁ? S vývojem filozofických názorů na povahu jazyka a jeho úlohu v našem rozumění světu nebo s možnými řešeními podobných problémů se seznámíte v našem kurzu Filozofie a jazyk.

12 Předpokládá se, že se studenti v rámci jednotlivých specializací budou v rámci seminárních či diplomových prací věnovat výzkumu. Při obou studijních programech bude fungovat obecně lingvistické pracoviště primárně zaměřené na výzkum. Dané bloky povinně volitelných předmětů jsou koncipovány jako odpovídající týmům vědeckých pracovníků zaměřených v konkrétním směru. Jednotlivé bloky garantující vyučující jsou v daných oblastech obecné lingvistiky či věd s ní kooperujících předními českými, respektive světovými kapacitami. Prof. RNDr. dr hab. J. Andres, CSc. Prof. PhDr. J. Černý, CSc. Prof. PhDr. J. Kořenský, DrSc. Prof. PhDr. E. Lotko, CSc. Prof. PhDr. RNDr. J. Štěpán, CSc. Doc. PhDr. L. Veselovská, M.A., Dr.

13 Přijímací řízení proběhne formou pohovoru zaměřeného na uchazečovu dosavadní profilaci, motivaci ke studiu obecné lingvistiky a předmět jeho diplomové práce, případně na jeho další výzkumné zaměření. Aktuality a mnohé další je k dispozici na našich webových stránkách.webových stránkách Přihlášky ke studiu podávejte do , e-přihláška a informace k přijímacímu řízení jsou dostupné na této adrese. této adrese Informace o katedře bohemistiky naleznete na této adrese.této adrese kontakty pro případné dotazy


Stáhnout ppt "Obecná lingvistika ( magisterské navazující dvouoborové studium prezenční ) ‏ Obecná lingvistika a teorie komunikace (magisterské navazující jednooborové."

Podobné prezentace


Reklamy Google