Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Nová mutace v genu ATP8B1/FIC1 u nemocného s benigní rekurentní intrahepatální cholestázou Nová mutace v genu ATP8B1/FIC1 u nemocného s benigní rekurentní.

Podobné prezentace


Prezentace na téma: "Nová mutace v genu ATP8B1/FIC1 u nemocného s benigní rekurentní intrahepatální cholestázou Nová mutace v genu ATP8B1/FIC1 u nemocného s benigní rekurentní."— Transkript prezentace:

1 Nová mutace v genu ATP8B1/FIC1 u nemocného s benigní rekurentní intrahepatální cholestázou Nová mutace v genu ATP8B1/FIC1 u nemocného s benigní rekurentní intrahepatální cholestázou Jirsa M., Budišová L., Taimr P., Cebecauerová D., Dvořáková L., Hřebíček M., Brodanová M., Vítek L., Wurm P., Hůlek P. Podpořeno grantem IGA MZ ČR reg.č. NM/

2 Benigní rekurentní intrahepatální cholestáza (BRIC, syndrom Summerskill- Walsheův) Geneticky podmíněná intrahepatální cholestáza Ataky žloutenky provázené úporným svěděním Manifestace obvykle do konce 2. dekády, trvání ataky týdny až řadu měsíců, počet atak 1 až 30 za život Laboratorně hyperbilirubinémie, zvýšená aktivita ALP a koncentrace sérových žlučových kyselin Normální S-GMT a cholesterol Prognóza většinou dobrá, asi 6% progreduje v cirhózu

3 Protein ATP8B1/FIC1 Exprimovaný v apikální membráně hepatocytů, cholangiocytů, enterocytů a acinárních buněk pankreatu, nízká exprese v řadě dalších tkání Funkce neznámá, hypotézy: flipáza membránových fosfolipidů transportér hydrofobních žlučových kyseli iontový kanál

4 Gen ATP8B1/FIC1 je lokalizovaný na 18q21, zaujímá 98kb sestává z 27 exonů kóduje ATPasu o MW 140 kDa

5 mutaceexondůsledekzdroj T1982C17I661TBull del920795delGNRBull 1998 Splice site24Skipped exonvan Ooteghem 2002 Mutace v genu ATP8B1/FIC1 asociované s BRIC

6 Pacient M.K. – anamnéza RA: negativní 1972 protrahovaná novorozenecká žloutenka 1973 žloutenka po varicele, závěr nejasný, léčba kortikoidy 1975 dvouměsíční ataka žloutenky 1976 roční ataka, chir. revize žluč. cest bez patol. nálezu 1990 po sinusitidě další ataka, vyloučena IHE, normální ERCP, závěr nejasný, opět léčen kortikoidy x jaterní biopsie 1998 další ataka, hosp. na Ústavu Klin. Imunologie LFHK OA, NO:

7 Pacient M.K. – laboratorní nálezy, USG a ERCP FW 50/86 KO: anémie, leuko 12 Hyperbilirubinémie, ALP 14,4  kat/l, celk. žluč. kyseliny 220  mol/l GMT a cholesterol opakovaně normální Fe, transferin, Cu, ceruloplasmin, alfa1-AT v normě Imunologická vyšetření v normě USG jater a žluč. cest bez patol. nálezu ERCP bez patol. nálezu 4. jaterní biopsie: intrahepatální cholestáza bez známek přestavby

8 Určení sekvence ATP8B1/FIC1 z genomové DNA Izolace genomové DNA z periferních leukocytů  PCR amplifikace jednotlivých exonů  Agarosová elektroforéza  Izolace produktů z gelu  Sekvenační PCR s univerzálními značenými primery  Sekvenování

9 M.K. – heterozygotní bodová mutace v 17. exonu ATP8B1 T1982T+C  M.K. kontrola...GCTACAAGGAAATTGAAGAAAAAGAATTTACA......CGATGTTCCTTTAACTTCTTTTTCTTAAATGT... Tsp509I 95 bp14 bp

10 M.K. – heterozygotní delece ve 24. exonu ATP8B1 Mutovaná alela: G G G G A C A T C G A T G... Normální alela : G G G G T C C T A A C A T... del3122TCCTA ...CTTGTTGCATGGGGTCCTAACATCGATGATC......GAACAACGTACCCCAGGATTGTAGCTACTAG... M.K. kontrola EcoO109I 715 bp220 bp

11 Vyšetření rodiny Restrikční analýza delece v 24. exonuRestrikční analýza mutace v 17. exonu MK PeKPaKPV

12 Ověření sekvence exonu 24 genu ATP8B1/FIC1 z klonovaného fragmentu DNA PCR amplifikace exonu 24 z genomové DNA  Agarosová elektroforéza, izolace produktu  ligace do vektoru pCR2.1-TOPO (Invitrogen)  Transformace buněk TOP10 (Invitrogen)  Kultivace transformovaných buněk, selekce klonů, izolace plasmidů  Sekvenační PCR s univerzálními značenými primery  Sekvenování

13 M.K. – sekvence mutované klonované alely 24. exonu genu ATP8B TGGGGTCCTAACATCGATGATCCTCTTCTTCATAC 3122  TTGATGTTAGGACATCGATG 3131 (3136 normální sekvence)  ACATCGATGTTGATGTTAGG

14 Potvrzení delečně - inzerční mutace metodou RFLP...CTTGTTGCATGGGGTCCTA ACATCGATGATC......GAACAACGTACCCCAGGAT TGTAGCTACTAG... EcoO109I202 bp167 bp...CTTGTTGCATGGGGACATCGATGTTGATGTTAGGACATCGATGATC......GAACAACGTACCCCTGTAGCTACAACTACAATCCTGTAGCTACTAG... Bsp143I 167 bp233 bp 16 bp

15 Závěr I 1. 1.Fenotyp choroby je u studovaného nemocného podmíněn dvěma různými mutacemi v genu ATP8B1/FIC Bodová mutace T1982C (I661T) je známá mutace asociovaná s BRIC bez progrese jaterního onemocnění 3. 3.Mutace v pozici 3122 je dosud neznámá delečně - inzerční mutace, jejímž důsledkem je záměna dvou hydrofobních aminokyselin 1041 Val-Leu uprostřed 7. membránové domény proteinu ATP8B1/FIC1 za Asp - -Ile-Asp - -Val-Asp - -Val-Arg + vedoucí pravděpodobně k chybnému vložení proteinu do buněčné membrány a tím k narušení jeho funkce

16 Závěr II 4. 4.Studovaný nemocný je prvním případem složeného heterozygota s BRIC 5. 5.Mutace nalezená v exonu 24 je novou v pořadí čtvrtou mutací nalezenou u pacienta s tímto onemocněním 6. 6.Prognóza pacienta M.K. je vzhledem k heterozygotnímu stavu pro mutaci T1982C (I661T) pravděpodobně příznivá

17 ? Máte v péči nemocné s chronickou cholestázou či s konjugovanou hyperbilirubinémií nejasné etiologie? Nabízíme spolupráci při jejich vyšetřování. Kontakt: MUDr. Milan Jirsa, CSc. Laboratoř experimentální hepatologie IKEM


Stáhnout ppt "Nová mutace v genu ATP8B1/FIC1 u nemocného s benigní rekurentní intrahepatální cholestázou Nová mutace v genu ATP8B1/FIC1 u nemocného s benigní rekurentní."

Podobné prezentace


Reklamy Google