Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Imunodeficience A.Šedivá Ústav imunologie UK2.LF a FN v Motole, Praha, Česká republika.

Podobné prezentace


Prezentace na téma: "Imunodeficience A.Šedivá Ústav imunologie UK2.LF a FN v Motole, Praha, Česká republika."— Transkript prezentace:

1 Imunodeficience A.Šedivá Ústav imunologie UK2.LF a FN v Motole, Praha, Česká republika

2 Duben PID awereness week Týden primárních imunodeficiencí

3 Imunitní systém obecné obranné mechanismy vrozená imunitazískaná imunita B T CD4 plasm.b. T CD8 mDC pDC

4 Imunodeficience imunodeficience nádory alergie autoimunita primární vrozené poruchy, způsobené mutacemi genů pro jednotlivé složky imunitního systému incidence1: (deficit IgA) 1: (SCID) sekundární poruchy imunity nasedající na základní onemocnění

5 Primární imunodeficience T CD4 B plasm.b. T CD8 Klasické imunodeficience - monogenní, s mendelovskou dědičností, zasahující hematopoetické buňky, s náchylností k mnohočetným, opakovaným rekurentním, někdy až fatálním infekcím Nově zařazené imunodeficence – běžná i sporadická onemocnění, s dominantní i polygenní dědičností, neomezeny jen na hematopoetické buňky, vnímavost omezenému spektru infekcí, které nemusí být opakované ani závažné

6 Primární imunodeficience B T CD4 plasm.b. T CD8 vrozená imunitazískaná imunitaobecná obrana nepohyblivost řasinek deficity baktericidních složek deficity fagocytózy deficity komplementu deficity protilátkové deficity buněčné a kombinované

7 ESID registry 126 center pacientů

8 Vývoj imunity dítěte vývoj imunokompetentních buněk je spojen s hematopoezou, jež začíná v 1.měsíci embryogenese protilátky plodu v okamžiku narození jsou přeneseny od matky

9 Klinické příznaky primárních imunodeficencí protilátkové buněčné a fagocytární komplementové kombinované častost výskytu cca 70% 20% 10% 1% začátek po 6.měsíci po narození po narození různý příznaků až do dospěl. až do cca 2 let v dětství i dosp. příznaky IHCD neprospívání omfalitis SLE IDCD IDCD adenitidy DLE otitidy průjmy pyodermie pyogenní inf. artritidy dermatitidy otitidy otoky původci opouzdřené viry,pneumocysty stafylokoky Neisserie nemocí mikroby plísně plísně echoviry mykobakterie enterobakterie reakce na enterovirové všechny živé BCG nekonstantní očkování vakcíny vakcíny vakcína

10 Primární protilátkové deficience – vývoj B lymfocytů

11 Chybění B lymfocytů, snížení všech protilátek: X-linked agammaglobulinemiaX-linked agammaglobulinemia, μ-Heavy chain deficiency, Igα deficiency, BLNK deficiency, thymoma with immunodeficiencyμHeavy chainIgαBLNKthymoma with immunodeficiency B lymfocyty snížené, ale přítomné, snížení u 2 a více izotypů protilátek: common variable immunodeficiency (CVID), ICOS deficiency, CD19 deficiency, TACI (TNFRSF13B) deficiency, BAFF receptor deficiency common variable immunodeficiencyICOSCD19TACIBAFF receptor Normální počty B lymfocytů, snížení IgA, IgA, normální či zvýšené IgM: CD40L def.,AID deficiency, UNG deficiency, CD40 def.,NEMOAID deficiencyUNG deficiency Normální počty B lymfocytů s deficiencí izotypů nebo lehkých řetězců: heavy chain deletions, kappa chain deficiency, isolated IgG subclass deficiency, IgA with IgG subsclass deficiency, heavy chainkappa chain selective immunoglobulin A deficiency Deficit specifických protilátek s normálními počty B lymfocytů: transient hypogammaglobulinemia of infancyransient hypogammaglobulinemia of infancy Protilátkové deficience

12 Dva bratři s atypickou formou XLA XLA spojená s psychomotorickou retardací a hluchotou XLA exon 19 delece BTK DDP X 22q ‚contiguous deletion syndrome‘ Dystonia Deafness Protein DDP Mohr-Tranebjaerg syndrom, Mitochondriální onemocnění

13 CVID Nejčastější forma humorální deficience Genová podstata známa přibližně u 10% Kooperace B a T lymfocytů Časté autoimunitní komplikace CVID

14 Pacient – 17 letý chlapec Anamnéza Matka: arteriální hypertenze Její sestra: celiakie Otec: arteriální hypertenze V jeho rodině: časná hypertenze, T2D Sourozenci sestra: T1D, malý vzrůst sestra: autoimunitní thyroiditida, bronchiální asthma Kasuistika: 3. fyziologické těhotenství, 4450g, 52cm Normální vývoj i vzrůst v časném dětství Opakované respirační infekce 5-6x do roka pollinosis

15 Manifestace ve 2 letech věku, těžká diabetická ketoacidóza Type 1 Diabetes ale negativní autoprotilátky!!! Glutamic Acid Decarboxylase Autoantibodies GADA <0,300 kU/l Insulinoma-Associated-2 Autoantibodies IA-2A <0,500 kU/l Terapie: short acting insulin Actrapid + long acting insulin Levemir 1U/kg/day Špatná „compliance“, opakované dekompenzace Diabetes Nephropathie, malý vzrůst diagnostikována v16,5 letech Chronické renální selhání glomerulosclerosis

16 Imunodeficience Diagnostikována za hospitalizace v 16,5 letech Imunoglobuliny: snížení všech podtypů Chybění specifických protilátek: tetanus IgG 0,04 IU/ml, pneumococcus IgG 1,74mg/l, haemophilus IgG 0,04mg/l. IgG (g/l)0,760,731,86 IgA (g/l)0,11 0,12 IgM (g/l)< 0,04 IVIG 10g i.v.

17 Imunodeficience Typizace B panelu: zvýšení naivních (CD27neg) lymphocytů, zvláště „transitional B-cells“ Naive (CD27neg)89% Transitional B22% Switched Memory4.5% MZ like16% Plasmablasts0.4% CVID IVIG 10g/4weeks

18 CVID - Autoimunita Asi u 20% Často první manifestace Dermatologic Alopecia totalis Vitiligo Psoriasis Hematologic Immune thrombocytopenic purpura Autoimmune hemolytic anemia Autoimmune neutropenia Endocrinologic Hyperthyroidism Hypothyroidism Rheumatologic Vasculitis Systemic lupus erythematosus Rheumatoid arthritis Juvenile rheumatoid arthritis Sicca syndrome Gastrointestinal Inflammatory bowel disease Primary biliary cirrhosis Autoimmune hepatitis Pernicious anemia Atrophic gastritis Curr Allergy Asthma Rep. 2009; 9(5): 347–352

19 Molekuly, jejichž genová mutace je podkladem buněčného imunodeficitu

20 T-/B+ SCID γc deficiencyγc deficiency, JAK3 deficiency, interleukin 7 receptor chain α deficiency, CD45 deficiency, CD3δ/CD3ε deficiency.JAK3 deficiencyinterleukin 7CD45CD3δ/CD3ε T-/B- SCID RAG 1/2RAG 1/2 deficiency, Omenn syndromeOmenn syndrome adenosine deaminaseadenosine deaminase (ADA) and purine nucleoside phosphorylase (PNP) deficiencyurine nucleoside phosphorylase (PNP) deficiency DNA ligaseDNA ligase type IV deficiency, Artemis deficiency CD40 ligandCD40 ligand deficiency, CD40 deficiencyCD40 MHC class IIMHC class II deficiency CD3γCD3γ deficiency, CD8 deficiency, ZAP-70 deficiencyCD8ZAP-70 TAP-1/2TAP-1/2 deficiency Reticular dysgenesis Buněčné a kombinované deficience

21 SCID fenotyp a genotyp T-B+NK-SCID def. γ řetězce JAK -3 def. T-B- SCID RAG 1,2 def. Artemis def. ADA def. Omennův syndrom T -B+NK+ CD45 def. IL-7Rα def. CD3δ def. TCR CD3    ZAP-70 cytokine receptor  JAK-3 WASP p56 lck CD4 CD154 CD40L SLAM NFAT IL7R  RAG1,2

22 SCID

23 Dívka, narozená 2011 RA: první dítě, bez údajů v RA OA: První těhotentství, 36 týdne, možná skeletální dysplasise, kratší dlouhé kosti končetin Porod v temínu, sc. 3500g/49cm 8 týdnů – průjem, zvracení, teploty, neprospívání, intersticiální pneumonie lymfopenie, nízké imunoglobuliny, T-B+NK+ SCID, nízké proliferační testy, bez MF engraftmentu low proliferation, no engraftment Terapie: ATB (Amoksiklav, Klacid), Cotrimoxazol, Flukonazol, IVIG, Solumedrol

24 CMV intersticiální pneumonie, systémová CMV infekce, rotavirová enteritida V.J. – klinika Terapie: antivirová Ganciclovir, cidofovir Foscavir, cytotec korticosteroidy antibiotika, antimycotika Cotrimoxazol, ceftazidim mycamine oxygenotherapie Tx, MUD, ve 3 měsících, pupečníková krev Sepse

25 12 měsíců dysproporcionální růst, macrocephalie, krátké končetiny, řídké vlásky, metaphyseální dysplasie susp. Cartilage hair hypoplasia metaphyseal chondrodysplasia McKusick type V.J. – Cartilage hair hypoplasia

26 sekvenace RMRP genu (RNA component of mitochondrial RNA processing endoribonuclease) V.J. – genetika Heterozygous duplication in promotor region (-15_-5_dupGAAGCTGAGGA) from father Heterozygous mutation CR054280(+35 C/C → C/T) from mother obě mutace vedou k poškození funkce genu tzv. „compound heterozygosity“ Alela 1 NNNGANANCNNCCNGAAAACNNGNNNNNTAATCTCACGCCNCCAACTTTCTCACCCTA ATCATAAAACACAATTTCTTTAGGGCTATAAAATACTACTCTGTGAAGCTGAGGAGAAGC TGAGGACGTGGTTAGGGCTGAAGGCCTGTATCCTAGGCTACACACTGAGGACTCTGTTC CTCCCCTTTCCGCCCAGGGGAAAGTCCCCGGAACTCGGGCAGAGAGNGCCACGAGCAT ACGCACGGAGACATTCCCCGCTTCCCACTCCNAAGTCCCCCAAGAAGCGTATCCCGCTG AGCGGCGTGGCACGGGGGCGTCATCCGTCAGCTCCCTCTAGTTACGCAGGCAGTGCGT GTCCGCGCACCAACCACACGGGGCTCATTCTCAGCGCGGCTGTTTTTTGTTCCCGAAAN NNCGGCTAAATGCAGCCTCGACNTCCCCGGGNNCACGCGANGCNNCACCNCNGGCTC CCNANNAGNTGNNANNNNNNGNGNACNCCATNNNNNCNGNNTNNNNNNNGGCTA ATAN Alela 2 NNNGANANCNNCCNGAAAACNNGNNNNNTAATCTCACGCCNCCAACTTTCTCACCCTA ATCATAAAACACAATTTCTTTAGGGCTATAAAATACTACTCTGTGAAGCTGAGGACGTGG TTAGGGCTGAAGGCCTGTATCCTAGGCTACACATTGAGGACTCTGTTCCTCCCCTTTCCG CCCAGGGGAAAGTCCCCGGAACTCGGGCAGAGAGNGCCACGAGCATACGCACGGAGA CATTCCCCGCTTCCCACTCCNAAGTCCCCCAAGAAGCGTATCCCGCTGAGCGGCGTGGC ACGGGGGCGTCATCCGTCAGCTCCCTCTAGTTACGCAGGCAGTGCGTGTCCGCGCACCA ACCACACGGGGCTCATTCTCAGCGCGGCTGTTTTTTGTTCCCGAAANNNCGGCTAAATG CAGCCTCGACNTCCCCGGGNNCACGCGANGCNNCACCNCNGGCTCCCNANNAGNTGN NANNNNNNGNGNACNCCATNNNNNCNGNNTNNNNNNNGGCTAATAN

27 14,5 měsíců bez GVH bez infekcí komepletní chimérismus Normální imunitní funkce V.J. – rok po Tx

28 A phenotypic approach for IUIS PID classification and diagnosis: guidelines for clinicians at the bedside. Bousfiha AA, et al,Casanova JL. J Clin Immunol Aug;33(6):

29 SCID základní diagnostické testy Počet lymfocytů Imunoglobuliny IgG, A and M Imunofenotypizace T a B lymfocytů Rychlý překlad dítěte do specializovaného centra Detailní imunofenotypizace, upřesnění diagnózy Cílené genetické vyšetření Normální nebo zvýšené počty lymfocytů nebo vysoké hladiny imunoglobulinů nevylučují diagnózu SCID (Omennův syndrom,maternofetální engraftment…)

30 SCID specifické testy fenotypizace B a T panelu proliferační testy cytotoxické testy cytokiny a cytokinové receptory enzymové testy (ADA,PNP) zobrazení thymu a funkce testy apoptózy,biopsie uzlin či jiné tkáně mikrobiologická vyšetření bakterie, viry a plísně PCR přímým průkazem genetická analýza mutací TREC KREC

31 TRECs thymocyt Naivní T lymfocyt Efektorový T lymfocyt TREC TCR Excision Circle TREC

32 SCID screening The Journal of Allergy and Clinical Immunology (JACI), Kwan et al, milion novorozenců 14 SCID, 6 CID 40 dalších imunodeficiencí Celkový odhad 1:22000

33 TREC c opie s KREC c opi es Prahové hodnoty TREC/KREC SCID (9) diGeorge syndrom (13) Guthrie cards

34 Neutropenie Severe congenital neutropeniaSevere congenital neutropenia: ELA2 deficiency (with myelodysplasia), G-CSFR deficiency Kostmann syndrome, Cyclic neutropenia, X-linked neutropenia/myelodysplasia, Shwachman-Diamond syndromeELA2 G-CSFRKostmann syndromeCyclic neutropeniaX-linked neutropenia/myelodysplasiaShwachman-Diamond syndrome LAD Leukocyte adhesion deficiencyLeukocyte adhesion deficiency types 1, 2 and 3 Poruchy funkce fagocytů Chronic granulomatous diseaseChronic granulomatous disease: X-linked, AR Neutrophil glucose-6-phosphate dehydrogenase deficiencyglucose-6-phosphate dehydrogenase deficiency Specific granule deficiency Vrozená vnímavost mykobakteriálním infekcím IL-12IL-12 and IL-23 β1 chain deficiency,IL-12p40 deficiencyIL-23IL-12p40 Interferon γ receptor deficiency, STAT1 deficiencySTAT1 Fagocytární deficience Diagnostická vyšetření?

35 Fagocytární imunodeficience Chronická granulomatóza neschopnost fagocytů generovat reaktivní kyslíkové radikály - genový defekt jedné či více podjednotek NADPH oxidázy na X chromozom vázaná forma defekt v genu pro gp91-phox - membránově vázaná část molekuly cytochromu b558 autozomálně recesivní forma defekt v genech membránových či cytoplasmatických podjednotek p47-phox, p67-phox, p22-phox

36 Chronická granulomatóza 6 měsíců cervikální lymfadenopatie,horečka, hepatomegalie, splenomegalie 7 měsíců – absces měkkých tkání na hlavě, s osteomyelitidou a penetrací kosti (Serratia marcescens) Respirační infekce of 9 měsíců 18 měsíců Mnohočetné jaterní abscesy (Staph. epidermidis) Tx u obou, výborný púrůběh

37 Fagocytární imunodeficience LAD syndrom deficit adhezivních molekul LAD syndrom I. - deficit leukocytárních integrinů CD 18 LAD syndrom II. - deficit selektinů LAD syndrom III.- deficit KINDLIN 3, nutný k aktivaci integrinů na hematopoetických buňkách

38 Hyper IgE syndrom klinika a skórovací klasifikace opakované pneumonie ekzem Opakované kožní abscesy Charakteristický obličej Zadržené zuby Plicní cysty eosinophilie novorozenecký rash Další neobvyklé infekce Široký nos Vysoké patro hyperextensibilita Pathologické kosntní fraktury Opakované respirační infekce candidiasis skoliosis Woellner et al: Mutations in STAT3 and diagnostic guidlines for HIES, J Allergy Clin Immunol, february 2010 Points of each :

39 HIES - genetika mutace signal transducer and activator of transcription 3 (STAT 3)

40

41

42

43 Deficity komplementu Deficit časných složek koplementové kaskády Deficit pozdních složek komplemetové kaskády Deficity v alternativní dráze komplementu Deficity inhibičních složek – angioneurotický edém

44 Nové imunodeficience Genetická vnímavost infekcím Na rozdíl od klasických primárních imunodeficiencí tyto „nové imunodeficience“ jsou představovány specifickými poruchami v rozvoji imunitní odpovědi a vedou k vnímavosti pouze k určitým patogenům. J.L.Casanova

45 vrozená imunita Nové jednotky v oblasti interakce imunitního systému s infekcí Rozpoznání mikroorganismů v buňce probíhá na několika úrovních: TLR systém na membránách TLR na intracelulárních membránách Intracelulární sensory -NLRs, Nod1, Nod2, Ipaf, NALPs -Sensory virových infekcí RIG-I a Mda-5 -AIM cytoplasmatický sensor DNA

46 Nové imunodeficience Genetická vnímavost infekcím IRAK 4 deficience vnímavost Pneumokokovým infekcím NEMO a I  B deficience (dowmstream), signalizace i přes TNF vnímavost širšímu spektru infekcí, i viry a plísně Anhydrotic epidermal dysplasia TLR3, UNC93b Herpetická encefalitida Porucha produkce interferonů

47 Primární imunodeficience - vrozená imunita Imunodeficience asociované s mykobateriálními infekcemi a infekcí Salmonelou Mendelovská dědičnost vnímavosti k mykobakteriálním infekcím: „IL-12–IL-23–IFN axis“ Genyproteiny IFNGR1 IFN R1 IFNGR2 IFN R2 IL12RB1IL-12 receptor  1-chain (IL-12R  1) IL12Bp40 podjednotka IL-12 a IL-23 STAT1 IKBKGIKK (inhibitor of nuclear factor-  B kinase = NEMO)

48 Primární imunodeficience - vrozená imunita „Autoinflammatory syndromes“ Kryopyrinopatie – cryopyrin, NALP3 m.Crohn, Blau syndrom – NOD2 NLRs join TLRs as innate sensors of pathogens Fabio Martinon and Jürg Tschopp Department of Biochemistry, University of Lausanne online 20 June Pathogen-recognition receptors (PRRs) are key components of immune systems and are involved in innate effector mechanisms and activation of adaptive immunity. Since their discovery in vertebrates, Toll-like receptors (TLRs) have become the focus of extensive research that has revealed their significance in the regulation of many facets of our immune system. What makes TLRs so central and fascinating is their ability to recognize microbes and directly initiate specific signal transduction cascades that alert the host defences. In this review, we discuss the function and biology of a new family of PRRs, the NACHT-LRRs (NLRs), which include both nucleotide-binding oligomerization domains (NODs) and NALPs [NACHT-, LRR- and pyrin domain (PYD)-containing proteins], and underline some intriguing similarities between NLRs and TLRs that emphasize the role of NLRs as a complementary system for host–microbe interactions.

49 Inflamasom,IL-1

50 Monogenní autoinflamatorní onemocnění onemocněnízkratkadědičnostchromozomgen familiární středozemní horečka FMFAR16p13MEFV porucha TNFRSF1TRAPSAD12p13TNFRSF1 hyperIgD syndromHIDSAR12q24MVK Muckle-Wells synd.MWSAD1q44CIAS1 cryopyrin NALP3 familiární chlad.urtika FCU NOMID/CINCA pyog.artritis,pyod. gangr.,akné PAPAAD15q24PSTPIP1 Blau syndromAD16q12NOD2 CARD15

51 Vyšetření u primárních imunodefitů anamnéza klinické vyšetření laboratorní vyšetření KO imunoglobuliny specifické protilátky počet, rozložení a funkce lymfocytů komplement počet a funkce fagocytárních buněk genetické vyšetření další

52 Vyšetření u primárních imunodefitů Protilátkové deficity Základní testy Imunoglobuliny, vakcinační protilátky Specifické testy Vyšetření fenotypu B lymfocytů, podtřídy IgG, vakcinační protilátky proti novým očkováním Výzkumné testy Fenotypizace B panelu, biopsie uzlin či jiné tkáně, odpověď vůči neoantigenům, in vitro aktivace a buněk a sekrece protilátek, genetická analýza mutací

53 Vyšetření u primárních imunodefitů Buněčné deficity – T lymfocyty Základní testy Počet lymfocytů, rtg plic (thymus) Specifické testy Vyšetření fenotypu T lymfocytů, proliferační testy Výzkumné testy Fenotypizace T panelu, cytotoxické testy, cytokiny a cytokinové receptory, enzymové testy (ADA,PNP), zobrazení thymu a funkce, TREC, testy apoptózy,biopsie uzlin či jiné tkáně, genetická analýza mutací

54 Vyšetření u primárních imunodefitů Fagocytární deficience Základní testy KO, NBT test, IgE Specifické testy Chemoluminiscence, funkce fagocytů, baktericidní testy, chemotaxe Výzkumné testy Vyšetření adhezivních molekul, vyšetření enzymů (MPO, G6PD, NADPH oxidáza), genetická analýza mutací

55 Vyšetření u primárních imunodefitů Deficity komplementu Základní testy CH50, C3, C4 Specifické testy Aktivační testy Výzkumné testy Aktivace alternativní dráhy, funkční testy, genetická analýza mutací

56 Terapie primárních imunodeficiencí Substituce Enzymy (PEG-ADA), cytokiny (IFN  ), imunoglobuliny (IVIG, SCIG,IMIG) Antiotická a antimykotická terapie Transplantace (světová priorita, 1968) kmenové buňky krvetvorby, kostní dřeň, pupečníková krev Thymus a thymová tkáň Genová terapie (světová priorita,2000) „Bubble boy“, 1969 USA „Bezmikrobní dítě“, 1977 Československo

57 Terapie primárních imunodeficiencí Antibiotika Profylaxe Pneumomocystis carinii Trimetoprim-Cotrimoxazol (2x denně, 3x týdně či jiné režimy) Kontinuální antibiotická terapie TMP/SMX denně v poloviční terapeutické dávce Azitromycin plná dávka 3 dny + 11 denní pauza Intraconazol u CGD Profyaktická antibiotika Stomatologické a chirurgické výkony Amoxycilin-gentamycin iv.před a 8 a 18 hodin po výkonu nebo po. různé režimy

58 Terapie primárních imunodeficiencí IVIG substituční léčba imunoglobuliny intravenosní imunoglobulinysubkutánní imunogloubliny indikace Brutonova agamaglobulinémie CVID hyperIgM syndrom Wiskott-Aldrichův syndrom fagocytární deficience další onemocnění intramuskulární imunoglobuliny hypo a agamaglobulinémie

59 Terapie primárních imunodeficiencí Transplantace Orgánové transplantace Transplantace thymu a thymové tkáně Transplantace kostní dřeně HLA identický dárce Haploidentický dárce, T deplece Haploidentická Tx in utero MUD Pupečníková krev

60 Terapie primárních imunodeficiencí Genová terapie deficit ADA X vázaný SCID (LAD, chronická granulomatosa..)

61 Rozdělení sekundárních imunodeficiencí

62


Stáhnout ppt "Imunodeficience A.Šedivá Ústav imunologie UK2.LF a FN v Motole, Praha, Česká republika."

Podobné prezentace


Reklamy Google