Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Genetické metody v zoologii počítačová část II Radka Storchová.

Podobné prezentace

Prezentace na téma: "Genetické metody v zoologii počítačová část II Radka Storchová."— Transkript prezentace:

1 Genetické metody v zoologii počítačová část II Radka Storchová

2 DATABÁZE Primární databáze DNA sekvencí GenBank (Amerika) EMBL (Evropa) DDBJ (Japonsko) Databáze genů Entrez Gene RefSeq Databáze genových expresních dat UniGene GEO Databáze genomů NCBI Ensembl UCSC Genome Browser Důležité odkazy PROGRAMY BLAST Na stránkách NCBI, Ensembl BLAT Na stránkách USCS Primer3 – navrhování primerů bin/primer3/primer3_www.cgi In Silico PCR NCBI - tam najdu skoro vše: GenBank, Entrez Gene, UniGene, MapViewer, BLAST… ENSEMBL - Genome Browser, BLAST USCS – Genome Browser, BLAT, In Silico PCR


4 Existují nějaké známé sekvence této kachny? V jaké části genomu leží (autosomy, pohlavní chromosomy, mitochondrie)? Úloha 2 Návod: Sekvence hledáme v základních databázích nukleotidových sekvencí GenBank/EMBL/DDBJ. Stačí zadat latinský název druhu. Pokud u sekvence není napsaná lokalizace v genomu, můžeme ji zkusit „blastovat“ na genom kura domácího (v databázi osekvenovaných genomů ENSEMBL). Všichni ptáci, stejně jako savci, mají stejný obsah genů na pohlavním chromosomu Z/X. Naopak geny na autosomech jsou u jednotlivých skupin na různých chromosomech. Výsledek: Polák kaholka (Aythya marila ) AY082413 Aythya marila beta fibrinogen gene, intron 7 (autosomální gen) AY112947 Aythya marila mitochondrial D-loop, partial sequence (mitochondriální sekvence)


6 Úloha 4 Zjistili jsme, že úsek na chromosomu X, mezi markery DXMit76 a DXMit110, způsobuje neplodnost hybridních samců u dvou poddruhů myši domácí. Zjistěte jaké geny v této oblasti leží a odhadněte, který z těchto genů by mohl sterilitu způsobovat. Mus musculus musculusM. m. domesticus F1 hybrid: STERILNÍ Návod: Seznam genů lze vyexportovat v databázi NCBI (přes Map Viewer), Ensembl (přes BioMart) či USCS. Porovnejte výsledky.

7 >seq01 CCACCAACAGACAGAGCAAA >seq02 ACTTTTTAACTGAGTCACCACAAGC >seq03 GAATTACAGGCATGCGTCCT >seq04 AGACAGACGTGATCCTGCCT >seq05 GAACCGCAAGTCATGAATCA >seq06 TGGAGGTCAGGAATCAAACA >seq07 AAAAGGATTGCAGGGACTACTG >seq08 GGTGCCTACCATGCACAATT >seq09 TTTCCATTTCCTCTTTTATTGTCC >seq10 CTACAAGGGAAAACCTCAGGG Úloha 5 Dostali jste 10 myších sekvencí. Zjistěte, jejich polohu v genomu. Jaký program k tomu použijete? Návod: Lze použít BLAST, ale protože hledáme úplně stejné sekvence můžeme použít i BLAT. Srovnej výstupy z obou programů.

8 Úloha 6 Chcete osekvenovat gen STYX, který leží na chromosomu X v oblasti, která je odpovědná za sterilitu samců (viz úloha 4), abyste zjistili, jestli neobsahuje mutaci způsobující sterilitu. Tento gen má ale v genomu několik kopií. Zjistěte, kde leží a čím se liší. Navrhněte primery specifické pro gen na chromosomu X. Návod: K nalezení kopií genu Styx použijte program BLAT nebo BLAST. Porovnejte alignmenty jednotlivých kopií. Navrhněte primery v programu Primer3 a pomocí In Silico PCR zjistěte, jestli amplifikují pouze kopii na chromosomu X. Výsledek: 3 kopie. Na chr 14 zdrojový gen s devíti exony. Na chr 7 a X jsou retrogeny bez intronů. Zjistěte, kdy došlo k retropozici genu STYX na chr 7 a chr X. Která retropozice je starší? Vyskytují se i u potkana? Výsledek: Retrogen na chr 7 starší, přítomen i u potkana. Retrogen na chr X mladší, není přítomen u potkana. chr 7chr X chr14

Stáhnout ppt "Genetické metody v zoologii počítačová část II Radka Storchová."

Podobné prezentace

Reklamy Google