Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Počítačová část 1. Databáze na internetu: (Databáze, navržení primerů) 2. Fylogenetická analýza.

Podobné prezentace


Prezentace na téma: "Počítačová část 1. Databáze na internetu: (Databáze, navržení primerů) 2. Fylogenetická analýza."— Transkript prezentace:

1 Počítačová část 1. Databáze na internetu: (Databáze, navržení primerů) 2. Fylogenetická analýza

2 Kde se dozvědět více? Kurz Computational Genomics (Marc VanRanst) Bioinformatics bookmarks (http://www.kuleuven.ac.be/rega/mvr/bioinformatics.htm) Úvod do bioinformatiky/Základy bioinformatiky (F. Cvrčková) Molekulární ekologie (letní semestr, populační genetika, analýza paternity)

3 Kde najdu adresy stránek z tohoto praktika? (http://www.natur.cuni.cz/~muncling)

4 DATABÁZE Primární databáze DNA sekvencí GenBank (Amerika) EMBL (Evropa) DDBJ (Japonsko) Databáze genů Entrez Gene RefSeq Databáze genových expresních dat UniGene GEO Databáze genomů NCBI Ensembl UCSC Genome Browser Důležité odkazy PROGRAMY BLAST Na stránkách NCBI, Ensembl BLAT Na stránkách USCS Primer3 – navrhování primerů In Silico PCR RepeatMasker NCBI - tam najdu skoro vše: GenBank, Entrez Gene, UniGene, MapViewer, BLAST… ENSEMBL - Genome Browser, BLAST USCS – Genome Browser, BLAT, In Silico PCR

5 Formáty sekvencí Fasta GenBank NEXUS Phylip

6 FASTA >gi|gi-number|gb|accession|locus – description GATCCTCCATATACAACGGTATCTCCACCTCAGGTTTAGATCTCAAC AACGGAACCATTGCCGACATGAGACAGTTAGGTATCGTCGAGAGTT ACAAGCTAAAACGAGCAGTAGTCAGCTCTGCATCTGAAGCCGCTGA AGTTCTACTAAGGGTGGATAACATCATCCGTGCAAGACCAAGAACC GCCAATAGACAACATATGTAACATATTTAGGATATACCTCGAAAAT AATAAACCGCCACACTGTCATTATTATAATTAGAAACAGAACGCAA AAATTATCCACTATATAATTCAAAGACGCGAAAAAAAAAGAACAA CGCGTCATAGAACTTTTGGCAATTCGCGTCACAAATAAATTTTGGC AACTTATGTTTCCTCTTCGAGCAGTACTCGAGCCCTGTCTCAAGAAT GTAATAATACCCATCGTAGGTATGGTTAAAGATAGCATCTCCACAA CCTCAAAGCTCCTTGCCGAGAGTCGCCCTCCTTTGTCGAGTAATTTT CACTTTTCATATGAGAACTTATTTTCTTATTCTTTACTCTCACATCCT GTAG

7 GenBank Obsahuje velmi podrobnou informaci o sekvenci: Locus Základní vlastnosti sekvence (název, délka, typ) Definition Výpis genů v sekvenci Accession Databázové přístupové číslo Version Verze dané sekvence Keywords Pod kterými klíčovými slovy ji lze najít Source organism Zařazení v systému Reference Článek, kde byla daná sekvence publikována Features Podrobný popis jednotlivých genů včetně jejich pozic Origin Sekvence

8 Sekvence v genetické bance Jsou známy nějaké sekvence mamuta (nejlépe cytochrom b)? Z jakého druhu mamuta jsou známé sekvence? Sekvence si chci stáhnout a porovnat Využijeme : 1. genetickou banku na stránkách NCBI (National Centre for Biotechnology Information ) 2. Volně dostupný program BioEdit

9 Alignment Přiřazení dvou i více sekvencí Sekvence si navzájem odpovídají Sekvence se liší Sekvence chybí

10 Pairwise Alignment (2 sekvence) –Globální: Zhruba stejně dlouhé sekvence Snaží se přiřadit od začátku až do konce sekvence –Lokální: Jen nejlépe shodující se místa obou sekvencí Sekvence různě dlouhé Např. BioEdit

11 Multiple Alignment –Více sekvencí –Hledá konzervativní místa –ClustalW Např. BioEdit, sms2/index.html

12 Příklad Zkuste provést alignment stažených sekvencí mamutů V programu BioEdit lze použít možnost: Accessory Applications – ClustalW Multiple Alignment

13 Čemu je tato sekvence podobná? BLAST B asic L ocal A lignment S earch T ool =========================================== Hledá lokální (částečné) podobnosti Na rozdíl od klasického alignmentu, umožňuje velmi rychle a efektivně prohledávat velké databáze

14 Úloha Vyhledejte sekvence nejpodobnější cytochromu b mamuta Použijeme BLAST na stránkách NCBI -

15 BLAST - Úloha ze života Sekvenuji mamuty Jedna ze sekvencí se mi nějak nezdá ctagccatgc actactcacc agacgcctca accgcctttt catcaatcgc ccacatcact cgagacgtaa attatggctg aatcatccgc taccttcacg ccaatggcgc ctcaatattc tttatctgcc tcttcctaca catcgggcga ggcctatatt acggatcatt tctctactca gaaacctgaa acatcggcat tatcctcctg cttgcaacta tagcaacagc cttcataggc tatgtcctcc cgtgaggaca aatatcattc tga V laboratoři se pracuje i s jinými zvířaty Chci zjistit, kdo mi zkontaminoval vzorky

16

17 Navržení vlastních primerů pro PCR

18 RepeatMasker Umožní vyhledat a „zakrýt“ oblasti, které jsou v genomu ve větším počtu (mikrosatelity, retrotranspozony a transpozony) Umožní nám to při navrhování primerů se vyvarovat nespecifickým amplifikacím při PCR Pouze ale organismy, které jsou již osekvenovány

19 Zamaskovaná sekvence Pomocí N nebo použitím malých písmen (většina programů určených pro analýzu sekvencí s nimi umí pracovat) >MusY.1 ACACTTTTTCTTTTGCATAATGCTGTGTGGAGATTTTGCAGACAGCATTGCTGTA AAATGCAGAGTAATTTCTGTAATGAGCTTGTGAAATATTGACTATTATGGCCCTCT CTAAGCATGGCTTTAATTATATTCTAGCACAGCAGCTTCTCTGGGGATACTCAGGT CAGATCACTGACTGAATGTTGTGTTCATTTGAAACNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCATTTGTTGGTGTGCTGA ATTCTGTTTTGTTTTGCTTTTAACCTAACTAGCTAGAAATTCTGTCAATCTTTTTTC CTTCCTAGAAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACACAGGCTTT

20 Primer3, Primer3Plus

21 TGCG{CGCTAAGA AA[CACACACACA]CGGAATTAGGGAAC}TT Included RegionTargetExcluded Region

22 Maskování repeatů Koncentrace Mg2+ Koncentrace dNTPs Rozestup primerů => délka amplifikované oblasti

23 Elektronická PCR Vezme dvojici primerů a zkouší, zda-li by PCR ve známém genomu amplifikovala pouze námi požadovanou oblast nebo i jiné oblasti Server UCSC (http://www.genome.ucsc.edu/) Lze i na NCBI

24 Úloha: Zjistěte zda-li se nachází v sekvencích mikrosatelity Zamaskujte je pomocí Repeatmaskeru Navrhněte kolem nich primery v Primer3 Zjistěte, které z těchto primerů jsou dále použitelné pomocí e-PCR

25 Vyhledání restrikčních míst WebCutter

26 Příklad Castor fiber Castor canadensis Je známa sekvence cytochromu b (Kuehn at al. 2000) V mrazáku mám enzym RsaI (GT/AC) Lze použít pro rychlé rozlišení druhů? Postup: Stažení sekvencí z genetické banky Vyhledání restrikčních míst pro RsaI Navržení primerů V praxi bychom samozřejmě výsledky ověřili sekvenováním.

27 Celé genomy

28 MAPY: Cytogenetická (proužky) Genetická (cM) Fyzická (Mb, sekvence, složeno z menších úseků - contig)

29 Příklad: Zjistěte přesnou pozici genu pro TLR1 u orangutana a zjistěte, zda se v jeho okolí vyskytují další TLR geny.

30 Samostatná úloha Stáhnout sekvenci cytochromu b alky velké (Pinguinus impennis), tak aby před začátkem i koncem sekvence cyt b byly dostatečně dlouhé oblasti na navrhnutí primerů Navrhnout primery na vybranou část sekvence Vyhledat podobné sekvence přes BLAST nebo prověřit příbuzné druhy Udělat alignment sekvencí sekvencí cytochromu b


Stáhnout ppt "Počítačová část 1. Databáze na internetu: (Databáze, navržení primerů) 2. Fylogenetická analýza."

Podobné prezentace


Reklamy Google