Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Evoluce genů. Obsah materielní substrát genů vnitřní periodicita genů původ exonů a intronů.

Podobné prezentace


Prezentace na téma: "Evoluce genů. Obsah materielní substrát genů vnitřní periodicita genů původ exonů a intronů."— Transkript prezentace:

1 Evoluce genů

2 Obsah materielní substrát genů vnitřní periodicita genů původ exonů a intronů

3 Obsah materielní substrát genů vnitřní periodicita genů původ exonů a intronů

4 Každý gen vzniká z genu genealogické vztahy mezi geny genové rodiny a nadrodiny – eukaryota asi 750 rodin ( ), každá v průměru 50 členů, 90 % velmi vzácných motivy a moduly

5 Mechanismy vzniku nových genů postupná transformace a změna (nebo obohacení) funkce genové fúze otevírání nových čtecích rámců mezidruhový přenos (transformace, hybridizace, syngenese) Přenos organelové DNA (promiskuitní DNA) genová duplikace (vymizení 3-7 mil. let, změna funkce) vznik z nadbytečné kopie u diploidů

6 mutace genová duplikace crossing over Vznik novéhu genu u diploida

7 Mechanismy vzniku nových genů postupná transformace a změna (nebo obohacení) funkce genové fůze otevírání nových čtecích rámců mezidruhový přenos (transformace, hybridizace, syngenese) Přenos organelové DNA (promiskuitní DNA) genová duplikace vznik z nadbytečné kopie u diploidů genomová duplikace

8 Obsah materielní substrát genů vnitřní periodicita genů původ exonů a intronů

9 TACACGATACAAAAAACATGAAGATCACTGTTCTCTTTAC AGTTACTGAGCACACAGGACCTCACCATGGGATGGAGCTG TATCATGCTCTTCTTGGCAGCAACAGCTACAGGTAAGGGG CTCACAGTAGCAGGCTTGAGGTCTGGACATATACATGGGT GACAATGACAATGACATCCACTTTGCCTTTCTCTCCACAG GTGTCCACTCCCAGGTCCAACTGCAGCAGCCTGGGGCTGA GCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAG GCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGG TGAAGCAGAGGCCTGGGCGAGGCCTTGAGTGGATTGGAAG GATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAG TTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCA GCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGA CTCTGCGGTCTATTATTGTGCAAGACACAGTGTTGCAACC ACATCCTGAGAGTGTCAGAAAACCTGGA

10 Původ periodicity mechanismus protoreplikace podporuje vznik pravidelné terciální struktury adaptivní vlastnost genů související s vlastnostmi genetického kódu vedlejší produkt genetického tahu

11 Mechanismus protoreplikace

12 Adaptivní vlastnost genů související s vlastnostmi genetického kódu Větší odolnost proti posunové mutaci Delší otevřené čtecí rámce u protogenů Obrana proti náhodnému zahajování transkribce

13 Větší odolnost proti posunové mutaci AAT GCC ATA ATG CCA TAA TGC CAT AAT GCC ATA... AAA TGC CAT AAT GCC ATA ATG CCA TAA TGC CAT... A AATGCCAT

14 Adaptivní vlastnost genů související s vlastnostmi genetického kódu Větší odolnost proti posunové mutaci Delší otevřené čtecí rámce u protogenů Obrana proti náhodnému zahajování transkribce

15 Delší otevřené čtecí rámce u protogenů náhodné 300 nukleotidů dlouhé nukleotidové řetězce, potom jen 0,82 % z nich nebude obsahovat žádný terminační kodón a bude tak kódovat souvislý protein délky 100 aminokyselin (30x 10NK – 60%) vznik nového proteinu posunem čtecího rámce více čtecích rámců ve stejném úseku DNA Snadnější vznik uspořádané terciální struktury

16 Adaptivní vlastnost genů související s vlastnostmi genetického kódu Větší odolnost proti posunové mutaci Delší otevřené čtecí rámce u protogenů Obrana proti náhodnému zahajování transkripce

17 V lidském genomu o délce 3000 Mb je přibližně tisíc genů. To znamená, že zde jsou jednotlivé geny od sebe v průměru odděleny nekódujícími úseky DNA o délce řádově 100 tisíc nukleotidů. častý motiv nekodujících úseků: AGCTG AGCTG AGCTG GGGTG. Cílové místo pro RNA polymerázu II: TATAAATA

18 Původ periodicity mechanismus protoreplikace adaptivní vlastnost genů související s vlastnostmi genetického kódu vedlejší produkt genetického tahu (přesah do oblasti intronů)

19 TACACGATACAAAAAACATGAAGATCACTGTTCTCTTTAC AGTTACTGAGCACACAGGACCTCACCATGGGATGGAGCTG TATCATGCTCTTCTTGGCAGCAACAGCTACAGGTAAGGGG CTCACAGTAGCAGGCTTGAGGTCTGGACATATACATGGGT GACAATGACAATGACATCCACTTTGCCTTTCTCTCCACAG GTGTCCACTCCCAGGTCCAACTGCAGCAGCCTGGGGCTGA GCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAG GCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGG TGAAGCAGAGGCCTGGGCGAGGCCTTGAGTGGATTGGAAG GATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAG TTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCA GCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGA CTCTGCGGTCTATTATTGTGCAAGACACAGTGTTGCAACC ACATCCTGAGAGTGTCAGAAAACCTGGA Jeden z možných důsledků existence periodicity – nerovnoměrnost v používání synonymních kodonů

20 Obsah materielní substrát genů vnitřní periodicita genů původ exonů a intronů

21 0,3330 celková délka exonů (kbp) 0,1 1, celková délka intronů (kbp)

22 obratlovci Caenorhabditis Drosophila Neurospora Saccharomyces Coprinus mikrosporidie Distiostelium Physarum Acanthamoeba zelené rostliny Chlamydomonas ruduchy Paramecium Tetrahymena Plasmodium Toxoplasma Phytopthora Naegleria Entamoeba Leishmania Trypanosoma trichomonády diplomonády Archaebacteria Eubacteria 1 intron/kb proteinového genu

23 Původ intronů Hypotéza časných intronů Hypotéza pozdních intronů –funkční význam intronů –introny jakožto tolerovaní paraziti

24 Původ intronů Hypotéza časných intronů –vystřihování úseků se stop kodony –geny jakožto lego –koincidence exonů s moduly, předpovězené introny (leghemoglobin, Culex) –fáze intronů (faze 0 introny korelují s moduly) –staré a mladé introny (lepší korelace u starých)

25 zastoupení (%) pozice vůči kodónům Zastoupení jednotlivých typů intronů

26 Původ intronů II Hypotéza pozdních intronů –fylogenetický předek často neměl (přibývání intronů ve fylogenezi), ale neplatí pro metazoa – parsimonie – opakovaný vznik –chabá koincidence s moduly, třídění z hlediska funkčnosti (přesun části modulu nefunkční)

27 Funkční význam intronů Evoluční potenciál druhu (vznik nových genů) Přepis více typů mRNA z jednoho genu Regulace exprese (posuny na nukleosomu)

28 a) b) Posun pozice regulačních elementů na nukleosomu

29 Funkční význam intronů Evoluční potenciál druhu (vznik nových genů) Přepis více typů mRNA z jednoho genu Regulace exprese (posuny na nukleosomu) Obrana proti nelegitimní rekombinaci

30 slabá homologie - rekombinace neprobíhá výrazná homologie - dochází k rekombinaci nefunkční produkty nehomologické rekombinace paralogy s vysokým stupněm homologie paralogy s vysokým stupněm homologie v oblasti exonů funkční nerekombinované geny a) b) Obrana proti nelegitimní rekombinaci

31 Funkční význam intronů Evoluční potenciál druhu (vznik nových genů) Přepis více typů mRNA z jednoho genu Regulace exprese (posuny na nukleosomu) Obrana proti nelegitimní rekombinaci Detekce či odstraňování chyb Žádná funkce – parazitická DNA

32 Shrnutí Každý gen vzniká z genu Geny lze uspořádat do genových rodin Protein je vytvářen z modulů, ty z motivů Geny často vykazují vnitřní periodicitu Existence této periodicity má řadu důsledků Moderní geny eukaryot jsou vytvářeny introny a exony Není jasné, kdy a proč vznikl splicing, většina autorů však předpokládá, že původní geny introny neobsahovaly


Stáhnout ppt "Evoluce genů. Obsah materielní substrát genů vnitřní periodicita genů původ exonů a intronů."

Podobné prezentace


Reklamy Google