Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Studium lidského genomu M. Jurajda. Historie studia DNA 1869 DNA poprvé izolována (Friedrich Miescher) 1919 Phoebus Levene určil složení DNA (báze, cukr,

Podobné prezentace


Prezentace na téma: "Studium lidského genomu M. Jurajda. Historie studia DNA 1869 DNA poprvé izolována (Friedrich Miescher) 1919 Phoebus Levene určil složení DNA (báze, cukr,"— Transkript prezentace:

1 Studium lidského genomu M. Jurajda

2 Historie studia DNA 1869 DNA poprvé izolována (Friedrich Miescher) 1919 Phoebus Levene určil složení DNA (báze, cukr, fosfátová skupina) 1928, Frederick Griffith přenesl pomocí DNA znak mezi bakteriemi – DNA nese genetickou informaci Archibald Garrod "one gene, one enzyme" hypothesis, Inborn Errors of Metabolism (1923)

3 Mendelian Inheritance in Man (MIM) 1966 Victor A. McKusick 1987 Online Mendelian Inheritance in Man (OMIM)

4 Human genome project HGP - počátky v polovině 80. let National Human Genome Research Institute při NIHNational Human Genome Research Institute Celera Genomics soukromá společnost (Craig Venter)Celera Genomics

5 Sekvenace DNA Sangerova metoda Primární sekvenace Resequencing

6 Prvotní sekvenace Při sekvenaci dosud neznámých úseků DNA se uplatňují dva přístupy –Primer walking –Shotgun sequencing

7 Shotgun sequencing DNA se rozdělí náhodně na fragmenty, které lze sekvenovat (800bp). Fragmenty se osekvenují a potom se pomocí počítače rekonstruuje původní sekvence. StrandSequence Original XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX First shotgun sequence XXXAGCATGCTGCAGTCATGCTXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXTAGGCTAXXXX Second shotgun sequence XXXAGCATGXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXCTGCAGTCATGCTTAGGCTAXXXX Reconstruction XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX

8 primer walking Dlouhý fragment se sekvenuje jako krátký fragment, čímž získáme sekvenci maximálně prvních 1000bp. Podle zjištěné sekvence navrhneme nový primer a pokračujeme dále. Templát Sekvenované úseky

9 Technické prostředky Kapilární sekvenátory Superpočítače Softwarové vybavení na „skládání sekvencí“ Nové „high throughput“ techniky

10 Výsledky 26 června 2000 oznámena znalost hrubé sekvence lidského genomu V dubnu 2003 oznámena kompletní znalost sekvence lidského genomu. (Dva roky před původně plánovaným koncem projektu).

11 Počet genů v lidském genomu Původní odhady – kolem Podle posledních výsledků – kolem

12 Další úkoly v sekvenování lidského genomu Popis variability lidského genomu –SNP –HapMap –Human Genome Diversity Project mapuje genetické rozdíly mezi lidskými rasami.Human Genome Diversity Project Porozumění sekvenci DNA – identifikace genů a regulačních oblastí a objasnění jejich funkce.

13 Studium genové exprese Semikvantitativní stanovení pomocí arrays následované kvantifikací pomocí real-time PCR technik

14 Genová exprese Expresní profily tkání během ontogenetického vývoje. Expresní profily zdravých tkání a tkání postižených chorobou (tumory, ischémie, atp.)

15 Identifikace genových variant podmiňujících multigenní nemoci Asociační studie Whole genome scan


Stáhnout ppt "Studium lidského genomu M. Jurajda. Historie studia DNA 1869 DNA poprvé izolována (Friedrich Miescher) 1919 Phoebus Levene určil složení DNA (báze, cukr,"

Podobné prezentace


Reklamy Google