Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Praktikum základů genomiky, zima 2007 Základy genomiky I. Úvod do bioinformatiky Jan Hejátko Masarykova univerzita, Laboratoř funkční genomiky a proteomiky.

Podobné prezentace


Prezentace na téma: "Praktikum základů genomiky, zima 2007 Základy genomiky I. Úvod do bioinformatiky Jan Hejátko Masarykova univerzita, Laboratoř funkční genomiky a proteomiky."— Transkript prezentace:

1 Praktikum základů genomiky, zima 2007 Základy genomiky I. Úvod do bioinformatiky Jan Hejátko Masarykova univerzita, Laboratoř funkční genomiky a proteomiky Laboratoř molekulární fyziologie rostlin

2 Praktikum základů genomiky, zima 2007  Zdrojová literatura ke kapitole I: Základy genomiky I.  Plant Functional Genomics, ed. Erich Grotewold, 2003, Humana Press, Totowa, New Jersey

3 Praktikum základů genomiky, zima 2007  Role BIOINFORMATIKY v současném pojetí FUNKČNÍ GENOMIKY Základy genomiky I.  Databáze  Vyhledávání homologií  Analytické nástroje  Spektrum „on-line“ zdrojů  Vyhledávání sekvenčních motivů, otevřených čtecích rámců, restrikčních míst….  GENOMOVÉ zdroje  PRIMÁRNÍ, SEKUNDÁRNÍ a STRUKTURÁLNÍ databáze  Další www genomové nástroje

4 Praktikum základů genomiky, zima 2007  V širším pojetí-zkoumá STRUKTURU a FUNKCI genomů Základy genomiky I.  V užším pojetí zkoumá FUNKCI jednotlivých genů - FUNKČNÍ GENOMIKA  používá zejména přístupy REVERZNÍ GENETIKY GENOMIKA-co to je?  Předpokladem je znalost genomu (sekvencí)- práce s databázemi

5 Praktikum základů genomiky, zima : 1 Přístupy „klasické“ genetiky „Reverzně genetický“ přístup ? inzerční mutageneze 5‘TTATATATATATATTAAAAAATAAAATAAA AGAACAAAAAAGAAAATAAAATA….3‘ GENOMIKA-co to je? role BIOINFORMATIKY ve FUNKČNÍ GENOMICE BIOINFORMATIKA FUNKČNÍ GENOMIKA

6 Praktikum základů genomiky, zima 2007  Role BIOINFORMATIKY v současném pojetí FUNKČNÍ GENOMIKY  Databáze  Spektrum „on-line“ zdrojů Základy genomiky I.

7 Praktikum základů genomiky, zima 2007 Databáze Spektrum on-line zdrojů

8 Praktikum základů genomiky, zima 2007 Databáze Spektrum on-line zdrojů  EBI  NCBI

9 Praktikum základů genomiky, zima 2007  Role BIOINFORMATIKY v současném pojetí FUNKČNÍ GENOMIKY  Databáze  Spektrum „on-line“ zdrojů  PRIMÁRNÍ, SEKUNDÁRNÍ a STRUKTURÁLNÍ databáze Základy genomiky I.

10 Praktikum základů genomiky, zima 2007 Primární databáze  EMBL,  zahrnují soubory primárních dat – sekvencí DNA a proteinů  DNA sekvence:  GenBank,http://www.ncbi.nih.gov/Genbank/Genb ankSearch.html  DDBJ,  Proteinové sekvence:  PIR,  MIPS,  SWISS-PROT,

11 Praktikum základů genomiky, zima 2007 Primární databáze  GenBank (NCBI)

12 Praktikum základů genomiky, zima 2007 Primární databáze

13 Praktikum základů genomiky, zima 2007  PROSITE,  databáze funkčních nebo strukturálních motivů získaných srovnáváním primárních dat (sekvencí) Proteinové sekundární databáze  PRINTS,

14 Praktikum základů genomiky, zima 2007  TRANSFAC Sekundární databáze DNA

15 Praktikum základů genomiky, zima 2007  PDB Strukturální databáze

16 Praktikum základů genomiky, zima 2007  Role BIOINFORMATIKY v současném pojetí FUNKČNÍ GENOMIKY  Databáze  Spektrum „on-line“ zdrojů  PRIMÁRNÍ, SEKUNDÁRNÍ a STRUKTURÁLNÍ databáze  GENOMOVÉ zdroje Základy genomiky I.

17 Praktikum základů genomiky, zima 2007 Primární data-genomové zdroje

18 Praktikum základů genomiky, zima 2007 Primární data-genomové zdroje

19 Praktikum základů genomiky, zima 2007 Primární data-genomové zdroje

20 Praktikum základů genomiky, zima 2007 Primární data-genomové zdroje

21 Praktikum základů genomiky, zima 2007 Primární data-genomové zdroje  Human Genome Browser

22 Praktikum základů genomiky, zima 2007 Primární data-genomové zdroje  TAIR, The Arabidopsis Information Resource,

23 Praktikum základů genomiky, zima 2007  Role BIOINFORMATIKY v současném pojetí FUNKČNÍ GENOMIKY  Databáze  Vyhledávání homologií  Analytické nástroje  Spektrum „on-line“ zdrojů  PRIMÁRNÍ, SEKUNDÁRNÍ a STRUKTURÁLNÍ databáze  GENOMOVÉ zdroje Základy genomiky I.

24 Praktikum základů genomiky, zima 2007 Analytické nástroje  BLAST

25 Praktikum základů genomiky, zima 2007  Velikost vyhledávacího slova (word size): bazí Podstata algoritmu BLAST (Basic Local Alignment Search Tool)  Hodnocení homologie pomocí matice PAM (Point Accepted Mutation) nebo BLOSUM (BLOcks Substitution Matrix)  Primární podobnosti (seed matches)  Rozšiřování oblasti homologie doprava i doleva  Zobrazení výsledků MRKEV [delece] MRKE [záměna] MRKY [inzerce] MRAKY M R. K E V | | | : M R A K Y. Matrice PAM 250

26 Praktikum základů genomiky, zima 2007 Analytické nástroje

27 Praktikum základů genomiky, zima 2007  Role BIOINFORMATIKY v současném pojetí FUNKČNÍ GENOMIKY  Databáze  Vyhledávání homologií  Analytické nástroje  Spektrum „on-line“ zdrojů  PRIMÁRNÍ, SEKUNDÁRNÍ a STRUKTURÁLNÍ databáze  GENOMOVÉ zdroje  Vyhledávání sekvenčních motivů, otevřených čtecích rámců, restrikčních míst…. Základy genomiky I.

28 Praktikum základů genomiky, zima 2007  Analytické nástroje

29 Praktikum základů genomiky, zima 2007 Analytické nástroje

30 Praktikum základů genomiky, zima 2007 Analytické nástroje

31 Praktikum základů genomiky, zima 2007 Analytické nástroje

32 Praktikum základů genomiky, zima 2007 Analytické nástroje

33 Praktikum základů genomiky, zima 2007 Analytické nástroje

34 Praktikum základů genomiky, zima 2007 Analytické nástroje

35 Praktikum základů genomiky, zima 2007 Analytické nástroje  VPCR

36 Praktikum základů genomiky, zima 2007 Analytické nástroje

37 Praktikum základů genomiky, zima 2007  Role BIOINFORMATIKY v současném pojetí FUNKČNÍ GENOMIKY  Databáze  Vyhledávání homologií  Analytické nástroje  Spektrum „on-line“ zdrojů  PRIMÁRNÍ, SEKUNDÁRNÍ a STRUKTURÁLNÍ databáze  GENOMOVÉ zdroje  Vyhledávání sekvenčních motivů, otevřených čtecích rámců, restrikčních míst….  Další www genomové nástroje Základy genomiky I.

38 Praktikum základů genomiky, zima 2007 www analytické nástroje  TIGR (The Institute for Genomic Research,

39 Praktikum základů genomiky, zima 2007  Role BIOINFORMATIKY v současném pojetí FUNKČNÍ GENOMIKY Základy genomiky I. shrnutí  Databáze  Vyhledávání homologií  Analytické nástroje  Spektrum „on-line“ zdrojů  Vyhledávání sekvenčních motivů, otevřených čtecích rámců, restrikčních míst….  GENOMOVÉ zdroje  PRIMÁRNÍ, SEKUNDÁRNÍ a STRUKTURÁLNÍ databáze  Další www genomové nástroje

40 Praktikum základů genomiky, zima 2007 Základy genomiky I. diskuse


Stáhnout ppt "Praktikum základů genomiky, zima 2007 Základy genomiky I. Úvod do bioinformatiky Jan Hejátko Masarykova univerzita, Laboratoř funkční genomiky a proteomiky."

Podobné prezentace


Reklamy Google