Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Určení rodičů (analýza paternity). Techniky Dříve minisatelitový DNA fingerprinting alozymy, mtDNA Dnes převážně mikrosatelity Další možnosti: AFLP, SNPs,

Podobné prezentace


Prezentace na téma: "Určení rodičů (analýza paternity). Techniky Dříve minisatelitový DNA fingerprinting alozymy, mtDNA Dnes převážně mikrosatelity Další možnosti: AFLP, SNPs,"— Transkript prezentace:

1 Určení rodičů (analýza paternity)

2 Techniky Dříve minisatelitový DNA fingerprinting alozymy, mtDNA Dnes převážně mikrosatelity Další možnosti: AFLP, SNPs, proteinový fingerprinting

3 mikrosatelity Tandemová opakování krátkých motivů Např. (CTTT) n Někdy i složitější (CTTT) n (CA) n Vysoce polymorfní Jednoduchá dědičnost Využití: analýza paternity, identity, populační struktury… CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT CTTTCTTTCTTTCTTTC CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT CTTTCTTTCTTTCTTTCTTTCTTT CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT

4 PCR Polymerase chain reaction (jak z málo DNA udělat hodně)

5 PCR Z celkové DNA si namnožíme jen úsek, který nás zajímá. Co se bude množit? To určí primery. Primery – krátké oligonukleotidy komplementární k úsekům ohraničujícím místo našeho zájmu. primer AGGGGACGTACACTCAGCTTT templát TCCCCTGCATGTGAGTCGAAA primer DNA templátu tento úsek se bude množit

6 Denaturace (obvykle 95°C) při zvýšení teploty se oddělí komplementární vlákna DNA Při ochlazení dojde k reasociaci

7 Primery přidané v nadbytku kmitají díky Brownově pohybu Některé se dostanou do blízkosti komplementárních míst

8 Při ochlazení primery přisednou rychleji než dojde k vzájemné reasociaci dlouhých vláken DNA (obvykle °C) V úseku mezi primery zůstanou vlákna DNA oddělena

9 Primery jsou prodlužovány přidáváním nukleotidů podle sekvence templátu (obvykle 72°C – optimum pro Taq polymerázu)

10 Při dalším zahřátí dojde k oddělení templátu a nově vzniklých vláken

11 Po ochlazení primery přisednou na templát i nově vzniklé fragmenty

12 Při 72°C dojde opět k prodlužování primerů a vzniku nových kopií

13 Při dalším zahřátí…

14 Ochlazení – nasednutí primerů72°C vznik nových fragmentů 95°C denaturace

15 Alely se liší délkou CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT CTTTCTTTCTTTCTTTC CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT +

16 Fragmentační analýza Probíhá v sekvenátoru

17

18 Elektroforéza gel kapilára

19 Elektroforéza gel kapilára detektor laserový paprsek

20 CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT CTTTCTTTCTTTCTTT GAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA primer GAAAGAAAGAAAGAAA primer Fluorescenční značení

21 Multiplex Více dvojic primerů v jedné reakci Různé značení Analýza se standardem standard

22

23 Určení paternity MatkaOtecMládě 1Mládě 2

24 Určení paternity prostým vyloučením (simple exclusion)

25 Kódlokus 1lokus 2lokus 3lokus 4 55 Soc. partner Matka Možní otci genotypy

26 Kódlokus 1lokus 2lokus 3lokus 4 55 Soc. partner Matka Identifikace mateřských alel u mláďat (na prvním lokusu málo alel – nebudeme se jím zabývat)

27 Kódlokus 1lokus 2lokus 3lokus 4 55 Soc. partner Matka Zjištěni shody otcovských alel s alelami sociálního partnera → nalezení mimopárových mláďat

28 Kódlokus 1lokus 2lokus 3lokus 4 55 Soc. partner Matka Dohledání genetických otců mimopárových mláďat mládě 57

29 Kódlokus 1lokus 2lokus 3lokus 4 55 Soc. partner Matka Dohledání genetických otců mimopárových mláďat mládě 59

30 Databáze na internetu

31 DATABÁZE Primární databáze DNA sekvencí GenBank (Amerika) EMBL (Evropa) DDBJ (Japonsko) Databáze genů Entrez Gene RefSeq Databáze genových expresních dat UniGene GEO Databáze genomů NCBI Ensembl UCSC Genome Browser Důležité odkazy PROGRAMY BLAST Na stránkách NCBI, Ensembl BLAT Na stránkách USCS Primer3 – navrhování primerů In Silico PCR RepeatMasker NCBI - tam najdu skoro vše: GenBank, Entrez Gene, UniGene, MapViewer, BLAST… ENSEMBL - Genome Browser, BLAST USCS – Genome Browser, BLAT, In Silico PCR

32 FASTA >gi|gi-number|gb|accession|locus – description GATCCTCCATATACAACGGTATCTCCACCTCAGGTTTAGATCTCAA CAACGGAACCATTGCCGACATGAGACAGTTAGGTATCGTCGAGAG TTACAAGCTAAAACGAGCAGTAGTCAGCTCTGCATCTGAAGCCGC TGAAGTTCTACTAAGGGTGGATAACATCATCCGTGCAAGACCAAG AACCGCCAATAGACAACATATGTAACATATTTAGGATATACCTCGA AAATAATAAACCGCCACACTGTCATTATTATAATTAGAAACAGAAC GCAAAAATTATCCACTATATAATTCAAAGACGCGAAAAAAAAAGAA CAACGCGTCATAGAACTTTTGGCAATTCGCGTCACAAATAAATTTT GGCAACTTATGTTTCCTCTTCGAGCAGTACTCGAGCCCTGTCTCAA GAATGTAATAATACCCATCGTAGGTATGGTTAAAGATAGCATCTCC ACAACCTCAAAGCTCCTTGCCGAGAGTCGCCCTCCTTTGTCGAGT AATTTTCACTTTTCATATGAGAACTTATTTTCTTATTCTTTACTCTCA CATCCTGTAG

33 GenBank Obsahuje velmi podrobnou informaci o sekvenci: Locus Základní vlastnosti sekvence (název, délka, typ) Definition Výpis genů v sekvenci Accession Databázové přístupové číslo Version Verze dané sekvence Keywords Pod kterými klíčovými slovy ji lze najít Source organism Zařazení v systému Reference Článek, kde byla daná sekvence publikována Features Podrobný popis jednotlivých genů včetně jejich pozic Origin Sekvence

34 Sekvence v genetické bance Jsou známy nějaké sekvence mamuta? Z jakého druhu mamuta jsou známé sekvence? (nejlépe cytochrom b) NCBI National Centre for Biotechnology Information

35 Chceme-li vyhledat sekvenci nejpodobnější k námi osekvenovanému neznámému vzorku, využijeme BLAST, opět na stránkách NCBI Čemu je tato sekvence podobná?

36 BLAST B asic L ocal A lignment S earch T ool ========================================= == Hledá lokální (částečné) podobnosti Na rozdíl od klasického alignmentu umožňuje velmi rychle a efektivně prohledávat velké databáze

37 Úloha Ze zbytků potravy medvěda v Pyrenejích jsem získal dvě sekvence. Čemu jsou tyto sekvence podobné? >sekvence1 atgaccaatattcgaaaaactcacccactaataaaaattgtaaacaacgcattcattgacctcccagctc cgtcaaacatctcatcatgatgaaactttggctccctcctaggcatctgc >sekvence2 ctagccatgcactactcaccagacgcctcaaccgccttttcatcaatcgcccacatcactcgagacgtaa attatggctgaatcatccgctaccttcacgccaatggcgcctcaatattctttatctgcctcttcctacacatcg ggcgaggcctatattacggatcatttctctactcagaaacctgaaacatcggcattatcctcctgcttgcaa ctatagcaacagcctt cataggctatgtcctcccgtgaggacaaatatcattctga Postup: Na stránce NCBI zadám, že chci použít BLAST. Pod možnostmi Basic BLAST vyhledám nucleotide BLAST a zadám tuto možnost. Do okénka vložím sekvenci například ve FASTA formátu. V možnosti Database zadám Others. Spustím BLAST.


Stáhnout ppt "Určení rodičů (analýza paternity). Techniky Dříve minisatelitový DNA fingerprinting alozymy, mtDNA Dnes převážně mikrosatelity Další možnosti: AFLP, SNPs,"

Podobné prezentace


Reklamy Google