Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Jan Pačes Ústav molekulární genetiky Jiří Vondrášek Ústav organické chemie a biochemie

Podobné prezentace


Prezentace na téma: "Jan Pačes Ústav molekulární genetiky Jiří Vondrášek Ústav organické chemie a biochemie"— Transkript prezentace:

1 Jan Pačes Ústav molekulární genetiky Jiří Vondrášek Ústav organické chemie a biochemie Bioinformatika pro PfUK 2002

2 syllabus L1 Úvod do bioinformatiky7. říjen 2001 L2 Biologické databáze (Jan Pačes)11. říjen L3 Alignment I (Jan Pačes)21. říjen L4 Alignment II (Jan Pačes)4. listopad L5 Predikce genů, fylogenetická analýza (Jan Pačes) 11. listopad L6 Vlastnosti proteinů (Jiří Vondrášek) L7 3D struktury, strukturní alignment (Jiří Vondrášek) L8 Sekundární motivy a jejich predikce (Jiří Vondrášek) L9 Protein folding (Jiří Vondrášek) L10 Molekulárni docking, drug design (Jiří Vondrášek) L11 Statistický aparát bioinformatiky

3 Aplikace: teorie biotechnologie farmacie medicína genetické inženýrství Informatika nad biologickými molekulami (daty). Bioinformatika extrahuje molekulární informační systém pro molekulární biologii. Bioinformatika je konceptualizovaná molekulární biologie (ve smyslu fyzikálně chemickém) na níž je aplikována informatika (odvozená od matematické informatiky a statistiky). bioinformatika

4 experimentální data počítačová analýza strukturovaná data (databáze), hypotézy sekvence geny kontigy funkce metabolismus (vše) struktura bioinformatika

5 velikosti genomů Mycoplasma genitalium0.58 Mbp Escherichia coli4.6 Mbp Saccharomyces cerevisiae16 chr.11.2 Mbp Arabidopsis thaliana5 chr Mbp Drosophila melanogaster5 chr.~137.0 Mbp Homo sapiens24 chr.~ 3.3 Gbp

6 centrální dogma molekulární genetiky reverzní transkripce DNARNAprotein transkripce translace replikace informacefunkce

7 DNA geny evoluční vztahy mezi geny a organizmy funkce proteiny struktura

8 sekvence

9 >jana (4797 nt) GAATTCGCCGCGGGGCTGCGCATCACCGATGCCGCCACCATCGAGATCGTCGAGATGGTACTGGCCGGCTCGATCAACAAGCAGCTCGTCGGCTACATCA ACGAAGCGGGCGGCAAGGCCGTCGGCCTGTGCGGCAAGGACGGCAACATGGTGTCCGCCACCAAGGCGACGCGCACCATGGTCGATCCGGATTCGCGGAT CGAAGAGGTGATCGACCTCGGTTTCGTCGGCGAGCCGGAGAAGGTCGACCTCACCCTGCTCAACCAGCTGATCGGCCACGAGTTGATCCCGGTGCTGGCG CCGCTGGCGACCTCCGCGTCGGGCCAGACCTTCAACGTCAATGCCGACACCTTTGCAGGTGCGGTTGCCGGTGCGCTGCGGGCCAAGCGCCTGCTGCTGC TGACCGACGTGCCGGGCGTGCTCGACCAGAACAAGAAGCTGATCCCCGAACTGTCGATCAAGGATGCCCGCAAGCTGATCGCAGACGGCACCATCTCGGG CGGCATGATCCCCAAGGTCGAGACCTGCATCTACGCGCTCGAACAGGGCGTCGAAGGCGTCGTCATCCTCGACGGCAAGGTCCCGCACGCAGTGCTGCTC GAATTGTTCACCAACCAGGGCACCGGCACGCTGATCCACAAGTGATGCGAGGCTGCGGCGACAACATCCGTCATGGCCGGGCTCGTCCCGGCCATCCACG TCTTTCCGGCGGTTTTCTCAGCAAGACGTGGATGCCCGGCACAAGGCCGGGCATGACGGGGTGGAGATCGCGCGCCCTCGCCGCCATTGTCACCACCCTC GCCCTCACCTCCGCCGCCCACGCCGACCTCAAGCTCTGCAACCGCATGAGCTACGTGGTCGAGACGGCGATCGGGGTCGATTCCAACGGCACCACCGCCT CGCGCGGATGGCTGCGGATTGATCCGGCGCAATGCCGGGTCGTGGTGCAAGGCGCGCTCAACGCCGACCGCATCATGCTGAATGCCCGCGCGCTGGCGGT GTACGGCGTCTCGCCGCTGCCGCAGAACGGCACTGACCGGCTGTGCATTGCCGAAGACAATTTCGTCATCGCCGCCGCGCGGCAATGCCGCGGCGGCCAA ACGCTCGCCGCCTTCACCGAGATCAAGCCCACCGACACCGAGGACGGCAACAAGATCGCTTATCTGGCGGAAGACTCCGGCTACGACGACGAACAGGCCA AACTCGCCGCGATCCAGCGGCTGCTGGTGATCGCCGGTTACGACGCCTCGCCGATCGACGGCGTCGACGGCCCGAAGACGCAGGCCGCGCTGTCCGCCTT CCTCAAGAGCCGAGGCCTGAAGCCCGAGATCGTCGATGCGCCGGATTTCTTCGACGTGATGATCAAGGCAGTGCAGCAGCCGTCCGGCAGCGGGCTGACC TGGTGCAACGACACCAAGTACAAGATCATGGCGGCCGTCGGCGAAGACGACGGCAAGACTGTCACCAGCCGCGGCTGGTACGGTGTTGCGCCCGGCCAAT GCCTGCGCCCCGACCTCGGCGCACAGCCGAAGCGGGTGTTCAGCTTCGCCGAAGCGGTCGACGGCAGCGGCAGGCCGGTGACCATCAAGGGCCGTGCGCT GAACTGGGGCGGCGGCGTGACGCTGTGCACGCGTGACAGCAAGTTCGAGATCGGCGAGCAAGGCGATTGCGCGGCGCGCGGCCTCGCCGCCACCGGCTTC GCCGCCGTCGATCTCAGTAGCGGCAAGACATTGAGGTTGTCCGCCCCATGATGCAGCTCGGCAAACGCGGCTTCGATCACGTCGAGACCTGGGTGTTCGA TCTCGACAACACGCTGTACCCGCATCACCTCAACCTATGGCAGCAGGTCGATGCGCGGATCCGCGACTTCGTCGCCGACTGGCTGAAGGTTTCGCCGGAA GAAGCCTTCCGTATCCAGAAGGATTACTACAAGCGCTACGGCACCACGATGCGCGGGATGATGACCGAGCACGGCGTTCACGCCGACGACTACCTGGCTT ATGTCCACGCCATCGACCATTCGCCGCTGCAGCCGAATCCGGCGATGGGCGATGCGATCGAGCGACTGCCGGGCCGCAAGCTGATCCTGACCAACGGCTC GACCGCCCATGCGGGCAAGGTGCTGGAGCGGCTCGGCATCGGCCATCATTTCGAGGCGGTGTTCGACATCATTGCGGCCGACCTCGAGCCGAAGCCGGCG CCGCAGACCTACCGCCGTTTTCTCGATCGCCATGGTGTCGACCCGGCCCGCGCCGCGATGTTCGAAGACCTCGCCCGCAACCTCACCGTGCCGCACCAGC TCGGCATGACCACCGTGCTGGTGGTGCCTGACGATAGCCAGGACGTGGTCCGCGAAGATTGGGAGCTTGAAGGCCGCGACGCCGCCCACGTCGATCACGT GACTGATGATTTGACAGGGTTCTTGGGGAAGCTGAGTTCGCTGTAGGCCGGGGACGCCTCCCAAGCGTCAATCGTCATCGCCGCCGGATGCAAGGCGGCT AGGTATTGCGGAGCGCTCGCGATCTTCCGTCCAATGCCCTGGGATACTGGATCGCCCGGACGAGCCGGGCGACGACGTTGAAGAGAGATGACGTGGCGTC ACCACATCCCCCGCCGTCATCGCCCGCGCAGGCGGGCGATGACTTGGCGGACGGGGCGGCGCCTTGACTCCGACCCGGCGAATCCGGACAACACTCCGCA AAACTCTCCCTGAAATCAGCCTCCCAAGGACCCGTCGATGCCGCTCACCGCCCTGGAATCTACCATCAACGCCGCTTTCGACGCGCGCGACACCGTTACC GCGGCGACGCAGGGCGAGATTCGTCAGGCCGTCGAGGATGCGCTCGATCTGCTCGACCAGGGCAAGGTGCGGGTGGCGCGGCGCGACGACTCCGGCGCCT GGACGGTCAATCAGTGGCTGAAGAAAGCAGTGCTGCTGTCGTTCCGGCTCAACGACATGGGCGTGATCGCCGGCGGCCCGGGCGGCGCCAACTGGTGGGA CAAGGTGCCGTCGAAGTTCGAGGGCTGGGGTGAGAACCGCTTCCGCGAGGCCGGCTTCCGCGCCGTGCCGGGCCGATCGTCGCGCGTCGGCCTTTATCGC CAAGACGCGGTACTGATCCGTCCTTCGTCAATCTCGGCGCTTACGTCGATGAAAGCACCATGGTCGAACACCTGGGCGACCGTCGGCTCCTGCGCCCAGA TCGGCAAGCGCGTGCACATCTCCGGCGGTGCCGGCATCGGCGGCGTGCTCGAGCCGCTGCAGGCCGGCCCGGTGATCATCGAGGACGACTGCTTCATCGG CGCCCGCTCCGAAGTCGCCGAAGGCGTGATCGTGCGCAAGGGTGCGGTGCTGGCGATGGGCGTTTTCCTCGGCGCCTCGACCAAGATCGTCGACCGCGAG ACCGGCGAAATCTTCGTCGGCGAAGTGCCGGAATATGCCGTGCTGGTGCCCGGCACCCTGCCCGGCAAGCCGATGAAGAACGGCGCCCCCGGCCCAGCCA CCGCCTGCGCGGTGATCGTCAAGCGCGTCGACGAGCGCACCCGTTCCAAGACCTCGATCAACGAATTGCTGCGGGACTGACACCTGTAGGAGGCGCGAAT GGACTGGACCACGCTGTTCTTCAGCTTTCGAGGTCGGATCAATCGCGCCAAATACTGGCTGGTCGGACTGATCTACGTCGCCGCCTGGATGG …. sekvence

10 Co lze v DNA najít? strukturní a organizační elementy evoluční vztahy geny promotory a další řídící elementy „cizí“ DNA všeobecná analýza

11 Rhodobacter capsulatus, GC profil všeobecná analýza

12 Homo sapiens, chromozóm 21, GC profil všeobecná analýza

13 Evoluční strom pTR5 rodiny lidských endogenních retrovirů všeobecná analýza

14 geny Jak najít geny?

15 Leucin Rhodobacter capsulatus antikodónpočet % CUA 3 <1 CUC CUG CUU UUA 0 0 UUG 27 3 Escherichia coli % geny

16

17 Sanger Ch21 (in Nature) cDNA GENESCAN EXOFISH Homo sapiens, chromozóm 21, predikce genů geny

18 alignment Jaké proteiny geny kódují?

19 PSI-BLAST HMMER SSEARCH BLITZ FASTA BLAST Dot plot 1:1 n:n n ClustalW MultAlign 1:n Dot plot SSEARCHftp://ftp.virginia.edu/pub/fasta BLITZ...http://www.ebi.ac.uk alignment

20 PSI-BLAST HMMER SSEARCH BLITZ FASTA BLAST Dot plot 1:1 n:n n ClustalW MultAlign 1:n FASTAhttp://www.ebi.ac.uk BLASThttp://ncbi.nlm.nih.gov/blast alignment

21 PSI-BLAST HMMER SSEARCH BLITZ FASTA BLAST Dot plot 1:1 n:n n ClustalW MultAlign 1:n PSI-BLASThttp://ncbi.nlm.nih.gov HMMER ClustalW MultAlign alignment

22 funkce Jakou mají geny v buňce funkci?

23 ja1 ACETYLGLUTAMATE KINASE EC ja2 ja3 ja4 TETRAHYDRODIPICOLINATE EC N-SUCCINYLTRANSFERASE ja5 ja6 SUCCINYL-DIAMINOPIMELATE EC DESUCCINYLASE ja1ja2ja3ja4ja5ja6ja1ja4ja6ja5 funkce

24

25 Bioinformatika Rhodopseudomonas palustris může syntetizovat aminokyselinu lysine biochemickou dráhou přes enzym EC Rhodopseudomonas palustris může syntetizovat aminokyselinu lysine biochemickou dráhou přes enzym EC


Stáhnout ppt "Jan Pačes Ústav molekulární genetiky Jiří Vondrášek Ústav organické chemie a biochemie"

Podobné prezentace


Reklamy Google