Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce.

Podobné prezentace


Prezentace na téma: "TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce."— Transkript prezentace:

1 TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce

2 Outline  Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymeráza  Princip procesu PCR  Optimalizace PCR  Typy PCR  Aplikace PCR a využití v praxi

3 Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dGMP)

4 “Koncept párování bazí je striktně konzervativní“ From Dr. John C. Perez, Professor and Director of the Natural Toxins Research Initiative, Texas A&M CytosineGuanine

5 Deoxyribosa a fosfát dávají DNA řetězci směr  konce dsDNA nejsou stejné  jednotlivé řetězce duplexu jsou k sobě komplementární  DNA rětězce duplexu mohou být denaturována a znovu spojena OH HO T AG T A C G C 5’ end3’ end 5’ end 3’ end

6 T m (melting temperature) je teplota při které je dsDNA z poloviny denaturována Singer, M., and P. Berg Genes and Genomes. University Science Books, Mill Valley, CA. p. 49 Tm je závislá na:  složení bazí  rozpouštědle  iontové síle  pH  délce DNA

7 DNA replikace in vivo vyžaduje několik enzymů  separace řetězců  syntéza krátkých RNA primerů  syntéza dvou nových DNA helixů  podílí se enzymy: DNA primáza helikáza DNA polymeráza DNA ligáza SSB-proteiny

8 Vlastnosti DNA polymerázy 1. POLYMERÁZOVÁ AKTIVITA  Replikace probíhá vždy ve směru od 5´na 3´konec  Nový nukleotid je přidáván tedy vždy na 3´OH konec. 2. 3'-5' exonukleázová aktivita -opravná funkce “proofreading” 3. 5´exonukleázová aktivita - odštěpuje RNA primer

9 DNA replikace in vitro vyžaduje pouze jeden enzym 1957 Arthur Kornberg dokázal existenci DNA polymerázy - DNA polymerase I in vitro polymeráza vyžaduje pouze: 4 deoxynukleotidy trifosfáty dsDNA templát primer - ssDNA nebo RNA s volnou 3'-OH DNA Polymeráza

10 Syntéza obou řetězců specifické dsDNA in vitro TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 5’ 3’ 5’ TTGAGAAAGGAATAAGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3’ 5’ 3’ Forward primer TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 5’ 3’ 5’ DNA POL dNTPs

11 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 5’ 3’ 5’ TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC TCTTTAGCTCATATACG 3’ 5’ 3’ Reverse primer TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 5’ 3’ 5’ dNTPs DNA POL GCATATACTCGATTTCT 5’ 3’ Syntéza obou řetězců specifické dsDNA in vitro

12 PCR: Co to je?  Polymerase Chain Reaction: znamená amplifikace (mnohonásobná replikace) relativně krátkých úseků specifické DNA  Základní nástroj molekulární biologie se vzrůstájícím významem i v dalších oborech (botanika, kriminalistika)  The idea  Ghobind Khorana 1971  Kary Mullis 1983 poprvé provedená mnohonásobná in vitro replikace ve zkumavce

13  Řetězová reakce vychází z DNA replikace  Spočívá v opakování cyklů denaturace (separace dsDNA), navázání primerů a elongace primerů (syntéza nového vlákna DNA) pomocí změn teploty  potřeba silného enzymu (polymerázy) který je schopen pracovat při vysokých teplotách  Polymeráza izolovaná z termofilní bacterie (Thermus aquaticus, Pyrococcus furiosus) zkr. TAQ, PFU Polymeráza Jak funguje PCR

14 PCR komponenty  Templátová DNA  vzorek k amplifikaci  Primery  krátké specifické úseky DNA zaručující specifitu amplifikace  dATP, dTTP, dCTP, dGTP  volné stavební jednotky DNA  Thermostabilní DNA polymeráza (e.g., Taq, Pfu)  Pufr a soli (KCl, MgCl 2 )

15 Proces PCR Velký nadbytek primeru, dNTPs a Taq POL k DNA templátu Proces

16 Problémy:  PCR je velmi citlivá na kontaminace  Častý problém - nespecifická amplifikace  Polymeráza pracuje i při nízských teplotách (e.g., během nastavování reakce)  “Hot start” PCR je řešení  Amplifikace je často možná i pro ne zcela známou sekvenci primerů např. DNA jiného biologického druhu  “Degenerované primery” (multiple verze s různými bázemi v klíčové pozici: …gacgt, …gacga, …gacgg, …gacgc)  “Touchdown PCR” s vyšší přesností v prvních cyklech  Maximální velikost produktu +/-5000 bazí pro standardní PCR: Long PCR kits mohou amplifikovat až 35 kbazí

17 Navrhování primerů  Primery by měly být bazí dlouhé  Nutná znalost alespoň části sekvence amplifikované DNA  3’ konec primeru je důležitý: vhodné aby zde byla G nebo C báze  Procentuální zastoupení G + C by mělo být 50-60% - ovlivňuje Tm (teplota kdy se váže primer na templát) Tm = (G+C)x4 + (A+T)x2  Primery v jedné reakci by měli mít srovnatelné Tm  Vyvarovat se repetitivním sekvencím  Vyvarovat se komplementaritě uvnitř či mezi primery

18 Navrhování primerů Příklad navržení primerů: Konvence: DNA se vždy zapisuje ve směru od 5´ku 3´konci Cílová sekvence: (priming místo podtrženo): 5’ TATAAGCCATAACGATATTGCTGAGTCAAGTCCACATATCAT ATGGATGAGAAATGCTTGTGGAGCTGATGTTGATTTGGAGA GACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCAAA CCAGTTAAAGAGTGTGCCAGTAGAG 3’ Forward Primer: 5’ ATG GAT GAG AAA TGC TTG TG 3’ Reverse Primer: 5’ ACT GGC ACA CTC TTT AAC TGG 3’

19 Praktické provedení PCR  PCR se provádí v termocyklerech kovový blok z ušlechtilého kovu snadné programování vyhřívané víko

20 Praktické provedení PCR objem v mikrozkumavce: ųL složení: Templátová DNA ng Primery pmols 10mM Tris-CL pH 9.0, 50 mM KCl MgCl mM 50 ųM každého nukleotidu dATP, dGTP, dTTP, dCTP 2 jednotky Taq polymerázy

21 Praktické provedení PCR  Počáteční denaturace 94 o C 3-5 min  denaturace 94 o C 30 sec  annealing ~55 o C 30 sec prodlužování 72 o C 1min/kilobáze  počet cyklů x

22 Praktické provedení PCR agarozová elektroforéza

23 PCR Optimalizace Složka Nízká specificita Vysoká specificita AnnealingTeplota - Tm MgCl 2 KCl Enzym, Primer pHnespecificky Formamid Nespecifická amplifikace

24 Základní typy PCR RT PCR (reverse transcriptase PCR)  vlastní PCR předchází syntéza cDNA z mRNA pomocí RT  jako primer sloužíGSP (gene specific primer) oligo dT random hexamer primer  hledání nových genů  tvorba cDNA knihoven  hledání mutací  zjišťování síly exprese různých genů

25  vychází z RT-PCR  používá se k hledání celé sekvence nového genu  nutná alespoň částečná znalost sekvence hledaného genu  vhodné pro klonování genů a jeho následnou funkční expresi (GMO) RACE PCR (rapid amplification of cDNA ends)

26 inverzní PCR  Amplifikace neznámých segmentů DNA

27 asymetrická PCR  sekvenace DNA, příprava hybridizačních sond  amplifikuje pouze jeden řetězec dsDNA SEKVENCOVÁNÍ DNA automatické sekvenátory využívající asymetrické PCR jednozkumavková reakce PCR s jedním primerem a dideoxyribonukleotidy (ddATP, ddGTP, ddCTP, ddTTP) dideoxyribonukleotidy značené 4 fluorescenčními markery velice citlivé elektroforetické rozdělení v kapiláře fluorometr s automatickým vyhodnocením

28 multiplex PCR  více amplifikací v jedné zkumavce  lékařská diagnostika nested PCR  2 po sobě jdoucí PCR  zvyšování specificity PCR

29 long PCR  amplifikace dlouhých úseků, polymerázové kokteily – např. Klenowův fragment + Pfu polymeráza  Pwo polymeráza z Pyroccocus woesei

30 in situ RT PCR  lokalizace translace a exprese genů

31 real time PCR  slouží k přesné kvantifikaci amplifikovaného produktu  využití fluorescence interkalačních barviv (etBr)  fluorometr je součástí termocykleru

32 Aplikace PCR a využití v praxi DIAGNOSTIKA V MEDICÍNĚ  detekce virových a bakteriálních onemocnění

33 Aplikace PCR a využití v praxi DIAGNOSTIKA V MEDICÍNĚ  detekce geneticky vrozených chorob (mutace DNA) -AS PCR alelicky specifická PCR primer navžen tak, že mutace odpovídá konci primeru fragmety DNA s nespárovanými konci se pohybují v elektrickém poli pomaleji -Real time PCR pomocí fluorescenční sondy odpovídající mutaci Např. detekce cystické fibrózy, choroba je podmíněná třínukleotidovou delecí v genu CFTR cystic fibrosis transmembrane regulator

34 Aplikace PCR a využití v praxi KRIMINALISTIKA VNRT – variable number of tandem repeat – vyskytují se na různých lokusech chromozomů a v populací kolísají mezi jedinci v počtu opakování mezi 4-40x např. GTGTGTGT

35 Aplikace PCR a využití v praxi ANALÝZA POTRAVIN  molekulárně-genetické zhodnocení surovin živočišného a rostlinného původu, které byly vyprodukovány klasickým pěstováním (chovem) nebo s použitím genového inženýrství  průkaz falšování potravin druhovou záměnou (rostlinného i živočišného původu)  identifikace mikroorganismů kontaminující potraviny nebo geneticky změněných mikroorganismů používaných jako startovací nebo ochranné kultury v produkci potravin. skotovceprasekozaTEST EVOLUČNÍ BIOLOGIE ORNITOLOGIE


Stáhnout ppt "TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce."

Podobné prezentace


Reklamy Google