Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

STRATEGIE MOLEKULÁRNÍ GENETIKY Kolektiv Laboratoře molekulární biologie Onkologické centrum J. G. Mendela Nový Jičín.

Podobné prezentace

Prezentace na téma: "STRATEGIE MOLEKULÁRNÍ GENETIKY Kolektiv Laboratoře molekulární biologie Onkologické centrum J. G. Mendela Nový Jičín."— Transkript prezentace:

1 STRATEGIE MOLEKULÁRNÍ GENETIKY Kolektiv Laboratoře molekulární biologie Onkologické centrum J. G. Mendela Nový Jičín

2 PŘÍMÁ DNA DIAGNOSTIKA hledá se kauzální mutace - musí být známá sekvence genu / oblasti - nevyžaduje biol. mat. od probanda - spolehlivost je 100% Volba metod: PCR, PCR/RE, ASO, ARMS,... Southern blot, Northern blot, klonování, SSCP, DGGE, TGGE, heteroduplexová analýza, sekvenování…


4 NEPŘÍMÁ DNA DIAGNOSTIKA - nehledá se kauzální mutace - sleduje se segregace mutované alely pomocí vysoce polymorfních lokusů - musí být jasná klinická diagnóza - vyžaduje biologický materiál od probanda - spolehlivost závisí na frekvenci rekombinace polymorfizmy: RFLP ( restriction fragment lenght polymorphism) VNTR ( variable number of tandem repeats) STR ( short tandem repeats)




8 VNTR – VARIABLE NUMBER TANDEM REPEAT GCTTTACCATTGGTAAAACTGA sekvence jednoho úseku možný počet tandemově se opakujících úseků: 1 - 7 frekvence jednotlivých alel: 1 (0.1), 2 (0.1), 3 (0.1), 4 (0.3), 5 (0.3), 6 (0.05), 7 (0.05)

9 STR SHORT TANDEM REPEAT CACACACACACACACACACACACACACACACACACA 1 0.05 2 0.1 3 0.2 4 0.2 5 0.2 9 0.04 6 0.1 7 0.07 8 0.04 A F

10 FIX gen FVIII gen Extragenové markery (proximální konec genu) Intragenové markery Extragenové markery (distální konec genu) Extragenové markery (proximální konec genu) Extragenové markery (distální konec genu) Intragenové markery

11 I. II. III. 1 54321 2 6 2745613 2 F* 1 2 1F211F21 1F211F21 1F111F11 1F111F11 1F111F11 1F111F11 1F111F11 1F111F11 1F121F12 1F121F12 2F212F21 2F212F21 2F212F21 1F111F11 2F222F22 2F222F22 2F222F22

12 FAKTORY OVLIVŇUJÍCÍ SPOLEHLIVOST MOLEKULÁRNĚ GENETICKÉ DIAGNOSTIKY 1)nesprávná klinická diagnóza 2)technické chyby 3)záměna vzorků 4)odběr mateřské tkáně místo fetálního, kontaminace 5)chybná interpretace výsledků 6)nedostatek biologického materiálu 7)neinformativita rodiny 8)non-paternita 9)rekombinace mezi mutací a sledovaným markerem 10)gonadální mozaicizmus

Stáhnout ppt "STRATEGIE MOLEKULÁRNÍ GENETIKY Kolektiv Laboratoře molekulární biologie Onkologické centrum J. G. Mendela Nový Jičín."

Podobné prezentace

Reklamy Google