Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Kolik gamet tvoří monohybrid? b) dvě d) čtyři a) jednu c) tři Otázka na 4ku Správně Špatně!

Podobné prezentace


Prezentace na téma: "Kolik gamet tvoří monohybrid? b) dvě d) čtyři a) jednu c) tři Otázka na 4ku Správně Špatně!"— Transkript prezentace:

1

2 Kolik gamet tvoří monohybrid? b) dvě d) čtyři a) jednu c) tři Otázka na 4ku Správně Špatně!

3 c) gen soubor všech alel jedince je: d) genotyp a) genom b) karyotyp Otázka na 3ku Správně Špatně!

4 c) ♀ Xx, ♂ xY b) ♀ Xx, ♂ xY d) ♀ xx, ♂ xY a) ♂ XY Potomky kterého pohlaví a s jakýma očima můžeme očekávat křížením červenookého samečka s bělookou samičkou, pokud je červená barva očí dominantní alela na X chromozomu Otázka na 2ku Správně Špatně!

5 d) 48%c) 60% b) 36%a) 40% V rozsáhlé panmiktické populaci bylo zjištěno 16% jedinců s recesivní formou kvalitativního znaku. Jaká je v této populaci frekvence dominantních homozygotů Otázka na 1ku Správně Špatně!

6 b) AUG-CUA-CCA-UGU-CGU-AAA Napište komplementární antikodony tRNA k následujícím kodonům mRNA UAC-GAU-GGU-ACA-GCA-UUU a) ATG-CTA-CCA-TGT-CGT-AAA d) TUG-CUT-CCT-UGU-CGU-TTTc) AGU-CUA-CCT-UGU-CGU-AAA Otázka na 4ku Správně Špatně!

7 Crossing-over: a) žádná z alternativ není správná b) zajišťuje zdvojení DNA d) způsobuje genomové mutace c) probíhá mezi nehomologními chromozomy Otázka na 3ku Správně Špatně!

8 Při křížení červenookého samečka octomilky s bělookou samičkou dostaneme: d) bělooké samečky a červenooké samičky b) polovinu potomků červeno- okých a polovinu bělookých bez ohledu na pohlaví a) všechno potomstvo červenooké c) červenooké samečky a bělooké samičky Otázka na 2ku Správně Špatně!

9 Strukturní gen: b) obsahuje informaci pro konkrétní formu příslušného polypeptidu d) je synonymum pro znak jedince a) je jedna molekula DNA c) má vždy pouze jednu formu Otázka na 1ku Správně Špatně!

10 Polyploidie je a)znásobení celé sady chromozomů b) množení polypů žahavců d) polynéská odnož voodoo c) výskyt buněk s různým počtem chromozomů v pletivu Otázka na 4ku Správně Špatně!

11 Autogamická populace: d) je tvořena jedinci, kteří se rozmnožují samoopylením b) je např.populace lidská a) je ve všech znacích panmiktická c) je tvořena organismy s odděleným pohlavím Otázka na 3ku Správně Špatně!

12 V lidské bílé krvince je: d) počet chromozomů 2n b) počet autozomů 2n a)totožný počet chromozomů jako v gametě c) aneuploidní počet chromozomů Otázka na 2ku Správně Špatně!

13 Má-li matka krevní skupinu O a otec rovněž O, mohou mít děti krevní skupinu: a) žádná z alternativ není správnáb) O,A,AB d) O,A,AB,B c) O,A Otázka na 1ku Správně Špatně!

14 Genofondem rozumíme: a)soubor všech alel všech členů populace b) žádná z alternativ není správná d) genetickou výbavu určité rodinyc) všechny geny určitého jedince Otázka na 4ku Správně Špatně!

15 b) nacházíme štěpení 1:1 Při křížení recesivního homozygota s heterozygotem: a) jsou potomci stejní d) dochází ke štěpení 1:2:1c) jsou potomci stejní jako jeden z rodičů Otázka na 3ku Správně Špatně!

16 Gregor Mendel by ve své době souhlasil s tvrzením, že: d) alely pro různé znaky se mohou při vzniku pohlavních buněk volně kombinovat b) geny jsou uloženy na chromozómech, kterých je v organismu zpravidla sudý počet a)genetická informace je uložena v jádře c) dědičnost je založena na prostorovém uspořádání nukleových kyselin Otázka na 2ku Správně Špatně!

17 Určete četnost alely podmiňující červenou barvu květu, jestliže víte, že gen, který tento znak podmiňuje, má pouze dvě alely, 64% rostlin v populaci je červeně kvetoucích, populace se nachází v rovnováze a alela pro červenou barvu květu je úplně dominantní: a) 40%b) 64% d) 48% c) 60% Otázka na 1ku Správně Špatně!

18 Kvantitativní znaky jsou: b) genotypově podmíněny vyšším počtem genů malého účinku d) genem velkého účinku a)obvykle podmíněny malým počtem genů malého účinku c) málo závislé na faktorech prostředí Otázka na 4ku Správně Špatně!

19 Vztah alel A a B pro krevní skupinu systému ABO je: b) kodominance d) úplná dominance a) recesivita c) dominance Otázka na 3ku Správně Špatně!

20 c) DNA b) fenotypu d) genu i syntetizovaném proteinu a) syntetizovaném proteinu Mutace vždy vede ke změně v(e): Otázka na 2ku Správně Špatně!

21 Hemofilie je dědičné onemocnění způsobené recesivní alelou uloženou na nehomologickém úseku pohlavního chromozomu X. Heterozygotní žena a zdravý muž mohou mít: b)všechny dcery zdravé, 50% synů postižených d) 50% potomků postižených bez ohledu na pohlaví a)všechny dcery postižené, všechny syny zdravé c) všechny dcery postižené, 50% synů zdravých Otázka na 1ku Správně Špatně!

22 Termínem partenogeneze se označuje: b)vývoj jedince z neoplozeného vajíčka d) vývoj rostlinného zárodku a)nepohlavní rozmnožování pomocí vegetativních buněk c) vznik více jedinců rozpadem jediného embrya Otázka na 4ku Správně Špatně!

23 b) AAGGUC Která z uvedených sekvencí je s největší pravděpodobností částí RNA? a) AAGGTC d) TTCCAG c) UUGGTC Otázka na 3ku Správně Špatně!

24 Při křížení dvou dominantních homozygotů se v jejich potomstvu: a)vyskytují pouze dominantní homozygoti b) dochází ke změně v F 2 generaci d) vyskytují recesivní a dominantní homozygoti v poměru 1:1 c) Vyskytují dominantní homozygoti pouze v F 1 generaci Otázka na 2ku Správně Špatně!

25 Geny regulátorové: a)se uplatňují při řízení genové exprese b) obsahují informaci pro syntézu polypeptidu d) určují strukturu chromozómůc) kódují pořadí nukleotidů v tRNA a rRNA Otázka na 1ku Správně Špatně!

26 c) jsou podmíněny nejčastěji jediným genem b) jsou např.tělesná výška a hmotnost d) jsou obvykle mimochromozomálně dědičné a)jsou výrazně ovlivňovány vnějším prostředím Kvalitativní znaky: Otázka na 4ku Správně Špatně!

27 Předpokládejme, že praváctví je dominantní znak (alela A) a leváctví recesivní (alela a). Jaké jsou genotypy pravorukých rodičů je-li jejich dítě levoruké? d) Aa x Aa b) AA x Aaa)Aa x aa c) aa x aa Otázka na 3ku Správně Špatně!

28 c) je jeden z projevů mimojaderné dědičnosti b) je fenotypový projev ovlivněný ženskými pohlavními hormony d) je jev vyskytující se pouze u rostlin a) je jeden z typů autozomální dědičnosti s projevem jen u žen Matroklinita: Otázka na 2ku Správně Špatně!

29 c) čtyři b) jednu dvoušroubovici d) žádná z alternativ není správná a) dva Kolik řetězců DNA obsahuje tento chromozóm? Otázka na 1ku Správně Špatně!

30 GCACCTTTGCGATAATCGGCGTATAGCCGTA je zápisem pořadí nukleotidů v molekule a) DNA b) tRNA d) mRNAC) rRNA Otázka na 4ku Správně Špatně!

31 Příbuzenské křížení v populaci má za následek: b) pokles četnosti heterozygotů d) vzestup počtu heterozygotů a) změnu genových frekvencí c) snížení počtu recesivních homozygotů Otázka na 3ku Správně Špatně!

32 Co znamená delece v genových mutacích? b) ztráta jednoho či několika nukleotidů d) záměna báze nukleotidu a) převrácení několika nukleotidů c) převrácení několika bazí Otázka na 2ku Správně Špatně!

33 Při transkripci: d) vzniká mediátorová RNA b)spojuje nukleotidy enzym DNA-polymeráza a)se řadí aminokyseliny do peptidového řetězce c)se informace z mRNA přepisuje do tRNA Otázka na 1ku Správně Špatně!

34 c) je náhodný výběr partnerů při křížení b) je příznačná pro samooplození d) je typická pro samosprašné rostliny a)se vyskytuje převážně u autogamie Panmixie: Otázka na 4ku Správně Špatně!

35 Meiotická segregace chromozómů: d) je náhodné rozdělení otcovských a mateřských chromozómů do gamet b) zahrnuje na molekulární úrovni transkripci a translaci a)je výměna částí nehomologních chromozómů c) je nezávislá kombinace chromozómů gamet do nových diploidních sad v zygotách Otázka na 3ku Správně Špatně!

36 Při úplné dominanci odhadujeme relativní četnost alely v populaci: a)odmocněním relativní četnosti recesivních homozygotů b) odmocněním relativní četnosti heterozygotů d) výpočtem kvadratickou rovnicí c) odmocněním relativní četnosti dominantních homozygotů Otázka na 2ku Správně Špatně!

37 c) A0, B0 b) AA, B0 d) nelze určit a)A0, BB Žena s krevní skupinou A se vdá za muže s krevní skupinou B. Jejich první a druhé dítě má krevní skupinu A, třetí má krevní skupinu B. Jaký je genotyp rodičů? Otázka na 1ku Správně Špatně!

38 Pohlavní chromozomy XY značí za normálních podmínek u člověka: b) mužské pohlaví d) Downův syndrom a) ženské pohlaví c) supermuže Otázka na 4ku Správně Špatně!

39 c) gen veškerá genetická informace uložená v DNA konkrétního organismu je: d) genom a) genotyp b) karyotyp Otázka na 3ku Správně Špatně!

40 c) substituce b) inverze d) inzerce a) delece V prvním řádku je sekvence normální alely, ve druhém potom sekvence alely mutované. Určete, o jakou mutaci se jedná: TGT GTA ATA CCG GGT TTG ACC TGT TTA ATA CCG GGT TTG ACC Otázka na 2ku Správně Špatně!

41 d) slepice i kohouti žíhaní c) slepice i kohouti žíhaní i tmaví (1 : 1) b) slepice tmavé, kohouti žíhanía) kohouti tmaví, slepice žíhaní U kura domácího je alela pro žíhané zbarvení peří (B) dominantní nad alelou odpovídající za hnědé nebo černé zbarvení bez žíhání (b). Gen pro zbarvení peří je lokalizován v nehomologické části pohlavního chromosomu Z. Určete fenotypový štěpný poměr v potomstvech tohoto křížení: hnědý kohout × žíhaná slepice Otázka na 1ku Správně Špatně!


Stáhnout ppt "Kolik gamet tvoří monohybrid? b) dvě d) čtyři a) jednu c) tři Otázka na 4ku Správně Špatně!"

Podobné prezentace


Reklamy Google