Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

2008. Organizace genomu  I prokaryotický genom není jen nahá DNA uložená v cytoplasmě, ale je spojena s řadou proteinů a je skládána do smyček  Eukaryotický.

Podobné prezentace


Prezentace na téma: "2008. Organizace genomu  I prokaryotický genom není jen nahá DNA uložená v cytoplasmě, ale je spojena s řadou proteinů a je skládána do smyček  Eukaryotický."— Transkript prezentace:

1 2008

2 Organizace genomu  I prokaryotický genom není jen nahá DNA uložená v cytoplasmě, ale je spojena s řadou proteinů a je skládána do smyček  Eukaryotický chromatin je však mnohem komplexnější  DNA jednoho „průměrného“ chromosomu člověka měří 6 cm (!)  DNA všech 46 lidských chromosomů měří 2 metry (!!)

3 Nukleosomy: „korálky na šňůře“  První úroveň sbalení DNA realizují histony. Histonů je v chromosomu přibližně stejné množství jako DNA!  Histony jsou tvořeny převážně z + nabitých aminokyselin, jako je Arg a Lys, které se dobře vážou k negativně nabitým fosfátům DNA  Existuje 5 typů histonů: H1, H2A, H2B, H3 a H4  Geny pro histony jsou prakticky totožné u všech eukaryot a dokonce i prokaryota mají podobné proteiny. Jedná se tedy jistě o velmi důležité a velmi konservativní geny

4 Eukaryotický genom

5 DNA eukaryotického chromosomu z vyvíjejícího se vajíčka mloka

6 Nukleosomy  Nukleosom je tvořen oktamerem histonů: H2A,H2B, H3 a H4 jsou každý obsaženy dvakrát  Histon H1 funguje jako svorka mezi jednotlivými nekleosomy  Histony opouští DNA pouze při replikaci…  …naopak při transkripci zůstávají připevněny k DNA – zdá se, že změnou tvaru a pozice nějak umožní RNA polymeráze čtení minus řetězce DNA

7 „Korálky na šňůře“ „Beads on a string“ N konec každého histonu směřuje ven z oktameru

8 DNA so obtáčí kolem histonu prostorový model

9 Histony  tradičně se myslelo, že přepisování DNA je řízeno transkripčními faktory sedající na 5´konec DNA  to je ale jen část příběhu  posttranslační úpravy histonů zřejmě odpovídají za regulaci genové exprese: na upravené histony nasedají proteiny, které určí, které části DNA budou přepsány RNA polymerázou (!)  velmi častá je acetylace N konců (to jsou ty, které „trčí“ ven) – acetylací se zmenšuje kladný náboj a histony jsou tak náchylnější k transkripci, neboť DNA se již na ně tak pevně neváže  schopnost acetylace je zřejmě klíčová pro život  pokud pokusně mají kvasinky zaměněný lysin na arginin (který si zachovává kladný náboj a nemůže být acetylován), kvasinky umírají

10 Histony  acetylace je dynamický proces  transkripční koaktivátory obsahují acetyltransferázy které histonové lysiny acetylují, korepresory mohou obsahovat deacetylázy, které acetyly odstraňují

11 Důležitost histonu H1 A: obvyklé sbalení DNA do 30nm vlákna E: bez H1 F: s H1

12 Vyšší úroveň organizace chromosomů 1. Nukleosomy tvoří vlákno 10nm  Oproti nahé DNA nukleosomy 7x zkracují délku DNA  jádro buňky člověka obsahuje 3,3x10 7 nukleosomů 2. S pomocí H1 vzniká 30nm vlákno  Oproti nahé DNA 30nm vlákno 40x zkracuje délku DNA 3. Toto 30nm vlákno tvoří smyčky, které jsou připevněny k nehistonovým bílkovinám, které tvoří tzv. proteinové lešení 300nm silné 4. Dalšími ohyby a skládáním těchto smyček vzniká chromosom – jedna chromatida je cca 700 nm silná

13 30 nm vlákno

14 300 nm vlákno

15 Chromosom

16 Chromosomy  Ovšem i interfásový chromosom si udržuje jistou úroveň sbalení  Předpokládá se, že v interfázi zůstává zachováno 30nm vlákno, které nehistonové proteiny váží k nukleární lamině a snad i k nukleární matrix  Toto připevnění tak dává každému z interfázových chromosomů své přesné místo v jádře a zabraňuje tak zamotání jednotlivých chromosomů

17 Heterochromatin a euchromatin  I u interfázových chromosomů se některé jejich části nachází ve velmi kondensovaném stavu, tak že jsou barvitelné a pozorovatelné mikroskopem – jedná se o tzv. heterochromatin. Heterochromatinová DNA není přepisována  Euchromatin = „pravý chromatin“ je přepisován a nachází se v mnohem více rozvolněném stavu

18 Odlišní exprese genů u odlišných buněk  všechny buňky našeho těla vznikly mitózou, první buňkou byla zygota  (téměř) všechny buňky našeho těla obsahují stejný genom  jak je tedy možné, že se naše tělo skládá z cca 200 typů buněk? (svalové, nervové…?)  typická lidská buňka přepisuje v daném čase jen asi 20 % svých genů  velmi diferencované buňky, jako jsou svalové buňky,přepisují dokonce ještě menší procento genů

19 Odlišní exprese genů u odlišných buněk  jednotlivé buňky se tedy od sebe liší ani ne tak tím, že by obsahovaly odlišné geny, nýbrž tím, že odlišné geny jsou exprimovány  otázkou tedy jest, jak může RNA polymeráza najít v nezměrném moři písmen začátek správného genu, který má v této buňce v tomto čase přepsat

20 Geny  „housekeeping genes“ – geny, které se přepisují ve všech buňkách  patří sem např. geny pro histony, geny pro ribosomální proteiny atd.

21 v každé z těchto oblastí může proběhnout regulace genové exprese

22 Kontrola genové exprese

23  Organizace chromatinu v jádře  DNA metylace. Zejména cytosin. Asi 5% cytosinů lidské DNA je metylováno. Velmi je metylována DNA neaktivního X chromosomu (Barrova tělíska). Metylované geny se předávají v jednotlivých mitózách dál, protože metylační enzymy jsou schopny je rozeznat a metylují dceřinný řetězec při replikaci – tapisérie metylovaných genů se tak při růstu tkáně předává dál. Metylace rovněž hraje roli při genovém imprintingu.

24 Kontrola iniciace transkripce  transkripce začíná vytvořením transkripčně iniciačního komplexu = transkripční faktory + promotor + RNA polymeráza  kontrolní elementy = segmenty nekódující DNA, na které se navazují transkripční faktory (striktně vzato je i promotor kontrolním elementem)

25 Kontrola iniciace transkripce

26 Role transkripčních faktorů  RNA polymeráza nemůže sama zahájit transkripci  jen jeden transkripční faktor rozeznává TATA box, jiné rozeznávají proteiny - buď jeden druhý nebo RNA polymerázu  takto ale probíhá transkripce jen pomalu a nedokonale  klíčem k rychlé transkripci jsou kontrolní elementy

27 Posilovače transkripce - enhancery  enhancery mohou být až tisíce pb vzdáleny od promotory proti proudu nebo i po proudu  mohou se dokonce nacházet i v intronech  do kontaktu s promotorem se dostávají ohybem DNA  aktivátor = transkripční faktor, který se váže na enhancer a popoří transkripci daného genu

28 Posilovače transkripce

29 Vazba transkripčních faktorů k DNA

30 Posttranskripční mechanismy kontrolují genovou expresi  mezi syntézou primárního transkriptu a činností aktivního proteinu v buňce se může nacházet řada kontrolních kroků  může např. dojít k alternativnímu sestřihu

31 Regulace degradace mRNA  prokaryotické mRNA mají typicky velmi krátkou životnost a enzymy je degradují po několika minutách - tím je také způsobeno, že bakterie pružně a rychle reagují na měnící se životní podmínky  u eukaryot mRNA přetrvává typicky hodiny, ale i dny a často i týdny  pověstná dlouhým životem je např mRNA pro oba globinové řetězce

32 Regulace degradace mRNA  degradace mRNA začíná enzymatickým zkracováním poly(A) konce  to rozběhne aktivitu enzymů, které odstraní čepičku  po odstranění čepičky nukleázy rychle odbourají mRNA od 5´ konce

33 Kontrola translace  většinou je regulována iniciace translace (připojení mRNA na malou podjednotku, připojení tRNA Met a připojení velké podjednotky)  např. v oocytu je velké množství předem připravených mRNA, které se po fertilizaci překládají ve správném čase a správném pořadí.  některé faktory zastavují translaci všech mRNA. Pokud např. ve vznikajícím erytrocytu je málo hemů, rewgulační proteiny zastavují celou translaci - většina mRNA je ovšem mRNA pro globiny

34 Kontrola translace  v oocytech mnoha organismů je připraveno množství mRNA - teprve po fertilizaci dojde k rychlé aktivaci translačních iniciačních faktorů. Výsledkem je explozívíní přepis mnoha mRNA  některé řasy a rostliny za noci zastavují translaci, kterou aktivuje až světlo

35 Posttranslační úpravy proteinů a jejich degradace  z insulinu musí být vyštěpena část řetězce, na jiné proteiny musí být navěšena sacharidová skupina, jiné proteiny mohou být aktivovány/deaktivovány reversibilním připojením fosfátové skupiny, jiné musí být dopraveny na správné místo v buňce - zde všude může probíhat regulace

36 Posttranslační úpravy proteinů a jejich degradace  např. cystická fibrosa je způsobena tím, že (díky mutaci v genu) protein, který má být normálně membránový a obsahuje v sobě kanál pro transport chloridových iontů, se nedostane na své místo do plasmatické membrány a v cytoplasmě je rychle degradován  např. cykliny musí mít krátkou životnost a musí být rychle degradovány, aby pracovaly správně

37 Posttranslační úpravy proteinů a jejich degradace  degradace začíná připevněním malé molekuly zvané ubiquitin na protein  obrovský proteinový komplex, zvaný proteasom, pak rozezná ubquitinovou „visačku“ a degraduje označený protein  cykliny, které vzdorují degradaci mohou způsobit rakovinu

38 Proteasom degraduje proteiny

39 Organizace genomu na úrovni DNA  U prokaryot většina DNA kóduje proteiny a jednotlivé geny jsou odděleny jen krátkými úseky nekódující DNA  U eukaryot naopak jen asi 1,5% (!) DNA kóduje proteiny  další malé procento kóduje nějaký jiný typ RNA než mRNA  Zbytek - nekódující DNA u eukaryot je tvořena částečně introny, ale především tzv. repetitivní DNA

40 Tandemové repetice  Tandemové repetice jsou krátké sekvence nukleotidů, opakované mnohokrát za sebou, např.  GTTACGTTACGTTACGTTACGTTACGTTAC  Sekvence GTTAC se může až několik set tisíckrát opakovat – evoluční význam tohoto jevu (je-li jaký) je záhadou. Možná se jedná jen o „odpadní“ DNA  Počet nukleotidů v sekvenci je obvykle

41 Tandemové repetice  Díky tomu, že tandemové repetice se opakují tolikrát za sebou, má tata část chromosomu poněkud jiné složení CG a AT než ostatní části chromosomu  Pokud je chromosom rozbit na malé kousky, tandemová DNA při centrifugaci vytvoří v centrifugační zkumavce pruh v poněkud jiné výšce, než zbytek chromosomu  Proto se této DNA začalo říkat „satelitní DNA“  Nyní je tento termín užíván pro všechnu tandemovou DNA

42

43 Satelitní DNA  Satelitní DNA se dělí na tři typy:  Satelitní DNA ( – 10 milionů opakování)  Minisatelitní DNA (100 – opakování)  Mikrosatelitní DNA (10 – 100 opakování)

44 Satelitní DNA  Některé genetické choroby jsou způsobeny nesprávným počtem repetic  Fragilní X chromosom = mentální retardace. Počet repetic CGG na nepřekládaném začátku genu je u zdravých osob přibližně 30. U nemocných se tento triplet vyskytuje ve stovkách nebo i tisících opakováních. Počet opakování se zvyšuje v průběhu generací  Huntingtonova choroba: zde je triplet CAG překládán (do glutaminu). U zdravých osob je počet repeticí do 35, u nemocných 40 – několik set

45 Satelitní DNA  Mnoho satelitní DNA se nachází v telomerách a v centromeře

46 Vmezeřená repetitivní DNA Intrespersed Repetitive DNA  Tvoří 25% - 40% DNA savců  Repetice zde nenásledují těsně za sebou, ale jsou rozptýleny na různých místech genomu  Repetice je obvykle dlouhá stovky až tisíce pb a její jednotlivé kopie se obvykle mírně odlišují  Alu elementy: tvoří 5% genomu člověka. Jedná se o 300pb dlouhou repetici. Výjimka: Ale elementy se překládají do proteinu. Význam tohoto proteinu v buňce, je-li jaký, není znám

47 Genové rodiny  U prokaryot i u eukaryot se většina genů vyskytuje jako unikátní sekvence DNA, v jediném provedení v haploidním genomu  Některé geny se však vyskytují ve více než jednom provedení. Soubor stejných nebo velmi podobných genů se nazývá multigenová rodina  Genovou rodinu můžeme chápat jako tandemovou repetici s velmi dlouhou (=jeden gen) repetiční jednotkou

48 Genové rodiny  Některé genové rodiny obsahují identické geny tandemově uspořádané - např. geny pro histony  Většinou však genové rodiny neobsahují geny pro bílkoviny, ale pro RNA  Za příklad mohou posloužit rodiny pro rRNA – zde jedna jednotka obshuje geny pro tři rRNA (18S, 5,8S a 28S rRNA)  Tato jednotka se opakuje ve stovkách – tisících kopiích. Primární transkript je štěpen na tři rRNA. Takto má buňka materiál pro miliony ribosomů

49 Genové rodiny

50 Multigenové rodiny  Klasickým příkladem jsou geny pro globiny – proteiny, ze kterých se sestavuje hemoglobin  Rodina na chromosomu 16 obsahuje geny kódující různé verze α-globinu  Rodina na chromosomu 11 obsahuje geny kódující různé verze β-globinu  Různé verze globinových genů jsou přepisovány v různých fázích embryonálního a fetálního vývoje

51

52

53 Globinová rodina  Nejpravděpodobnější vznik je opakovaným zdvojením původně jednoho genu  Rozdíly mezi jednotlivými geny pravděpodobně vznikly nahromaděním mutací v průběhu evoluce  Pseudogeny: útvar velmi podobný genu, ale buď se nepřekládá, nebo kóduje nefunkční produkt. Globinová rodina obsahuje několik pseudogenů

54 Transpozony a retrotranspozony  Transpozon = sekvence DNA, která se může přesunout z jednoho umístění na genomu do jiného  Pokud transpozon „skočí“ doprostřed jného genu, může jej vyřadit z činnnosti  Trasnpozony tvoří 50% genomu kukuřice a cca 10% genomu člověka  Většina transpozonů jsou retrotranspozony

55 Např. Alu elementy jsou retrotranspozony. U člověka aktivní transpozony nejsou známy.

56 Kontrola genové exprese  V průběhu buněčné diferenciace jsou zapínány a vypínány různé geny – výsledkem je, že se jedna buňka liší od druhé, např. neuron od svalové buňky  Typická buňka přepisuje v daném čase jen asi 3-5% svých genů  Enzymy přepisující DNA (RNA polymeráza) musí najít správné geny ve správném čase

57

58 Protoonkogeny  rakovina vzniká poškozením genů kontrolující buněčný růst a dělení, a to buď fyzikálními nebo chemickými agens (mutageny, X-zářením atd.)  protoonkogen = gen, který stimuluje normální buněčný růst a dělení  onkogen = gen, který způsobuje rakovinu  onco = řec. tumor, nádor

59 Změna protoonkogenu na onkogen  přesun genu na jiné místo v genomu  amplifikace (zmnožení) protoonkogenu  bodová mutace v protoonkogenu

60 Změna protoonkogenu na onkogen

61  Maligní buňky mají často chromosomové translokace, díky kterým se dostávají protoonkogeny do blízkosti silných promotorů a jsou přepisovány častěji. Jindy je to promotor, který se přesune do blízkosti protoonkogenu  mutace může způsobit, že protein je více aktivní nebo více odolný vůči degradaci

62 Tumor supresorové geny  translační produkty těchto genů normálně pomáhají zastavit nekontrolovatelný růst  translační produkty tumor supresorových genů mají normálně v buňce různé úkoly:  opravují poškozenou DNA  kontrolují adhezi buněk k sobě či k extracelulární matrix  jiné přímo inhibují buněčný cyklus

63 ras protoonkogen a p53 tumor supresorový gen  30% rakovin člověka má poškozený ras gen  50% rakovin člověka má poškozený p53 gen  Ras protein i p53 protein jsou součástmi drah, kterými je z cytoplasmy ovlivněna aktivita jádra

64 Ras protein a p53 protein

65 Ras protein  jedná se o tzv G protein (aktivovaný GTP), který je součástí dráhy, předávající signál růstového faktory přes celou cytoplasmu až do jádra  normálně je dráha spuštěna růstovým faktorem  mutovaný ras protein spouští dráhu i v nepřítomnosti růstového faktoru

66 p53 protein „guardian angel of the genome“  je tumor supresorový protein o hmotnosti Daltonů  p53 je trasnkripční faktor, který stimuluje syntézu proteinů inhibujících růst buňky:  aktivuje gen p21, jehož proteinový produkt se váže k cyklin-dependentním kinázám, čímž je získán čas pro opravu DNA  aktivuje geny, jejichž proteiny opravují DNA  pokud je DNA neopravitelná, aktivuje „sebevražedné“ geny, které rozběhnou apoptózu

67 Rakovinu způsobí až mnohonásobná mutace  …což vysvětluje, že rakovin přibývá s věkem  příklad: kolorektální karcinom nových případů v USA každý rok  nejprve vzniká polyp, tvořený „normálními“ buňkami, které se jen rychleji dělí  tumor roste a může se stát maligním - tak, že se v jeho buňkách hromadí mutace tvořící onkogeny a knock-outované tumor supresorové geny

68 Rakovinu způsobí až mnohonásobná mutace  tumor supresorové alely jsou většinou recesívní - musí tedy zmutovat obě  naopak onkogeny jsou většinou dominantní - stačí, aby zmutovala jedna  nakonec je aktivován gen pro telomerázu

69 Rakovina tlustého střeva

70 Další příčiny vzniku rakoviny  viry: asi 15% případů  retroviry způsobují leukémie  viry hepatitidy způsobují rakovinu jater  způsobují rakovinu děložního hrdla  buď přinesou s sebou onkogen, nebo se vloží do tumor supresorového genu, nebo aktivují protoonkogen

71 Dědičnost rakoviny  rakovina není dědičná obvyklou mendelovskou dědičností  dědičná může být např. jedna mutace tumor supresorového genu - potomstvo je tedy o jeden krok blíže k vypuknutí rakoviny  15% kolorektální rakoviny obsahuje již zděděné mutace, řada z nich zasahuje geny produkující proteiny opravující DNA

72 Rakovina prsu  v USA žen (!) každý rok  u 5%-10% silná dědičná disposice  zejména geny BRCA1 a BRCA2 (BReast CAncer) - jejich mutace podporuje vznik rakoviny prsu i vaječníků. Oba jsou možná tumor supresorové a jsou recesívní. Snad se i podílejí na opravě DNA

73 Rakovina prsu

74


Stáhnout ppt "2008. Organizace genomu  I prokaryotický genom není jen nahá DNA uložená v cytoplasmě, ale je spojena s řadou proteinů a je skládána do smyček  Eukaryotický."

Podobné prezentace


Reklamy Google