Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Genové čipy. co to je genový čip (DNA microarray)? DNA šikování nová technologie zavedená koncem devadesátých let geny nebo fragmenty genů (cDNA, EST)

Podobné prezentace


Prezentace na téma: "Genové čipy. co to je genový čip (DNA microarray)? DNA šikování nová technologie zavedená koncem devadesátých let geny nebo fragmenty genů (cDNA, EST)"— Transkript prezentace:

1 genové čipy

2 co to je genový čip (DNA microarray)? DNA šikování nová technologie zavedená koncem devadesátých let geny nebo fragmenty genů (cDNA, EST) jsou roboticky v přesně daných souřadnicích umístěny na mikroskopické sklo (plast) takto vytvořený genový čip se hybridizuje s RNA nebo cDNA určitého vzorku a následně počítačově srovná se standardem Northern Blot imobilizována mRNA se hybridizuje se značenou probou reprezentující jeden gen DNA Microarray imobilizované proby hybridizují se značenou mRNA reprezentující všechny exprimované geny

3 do jednoho čipu lze uložit informaci celého genomu (až ) komerčně připravované čipy se prodávají pro celé organismy, které mají odsekvencovaný genom u vlastních microarray se používají jen krátké oligonukleotidy reprezentující jednotlivé geny o známe funkci a všechny další EST získané z daného organismu velice náročná příprava (imobilizace desetitisíců prób na velmi malé ploše následuje označení srovnávaných populací mRNA většinou fluorescenčně promytí takto označené mRNA čipem vyhodnocení rozdílů – je není exprimovaný u nejmodernějších i jak moc vše je řízeno počítačově princip genových čipů

4 Macroarray & Microarray & DNA Chips Micro a macroarray: lepené Próby [0.6 kb kb] jsou PCR amplifikované celé cDNA nebo EST [expressed sequence tags] sekvence. Jsou roztříděny a přilepeny roboticky na nepórozní pevný nosič (plast). macroarray 1000 skvrn microarray skvrn. DNA čipy: syntetizované umělé (Affymetrix technologie) Próby jsou deoxyoligonucleo-tidy syntetizované na sklo speciální technikou (fotolitografie) Komerční čipy mají prób na 3 cm 2 Experimentální čipy i s miliónem prób na array.

5 práce s genovým čipem

6 Affymetrix technologie 50um 1.28cm

7 fotolitografie fotolitografie metoda pro syntézu Affymetrix čipů wafer (křemíková destička se předem promyje a aktivuje (reakční hydroxylové skupiny) ponoří se do silanu který zajistí jednolitou rovnoměrnou vrstvu ta se překryje maskou která je řízená počítačem a na přesně daných místech se pak světlem aktivuje hydroxy skupina na kterou se syntetizuje přesně určený nukleotid (podle databáze) opět se překryje vrstvou silanu a maskou maska se přesune a opět aktivuje světlem a opakuje se 25x syntéza 25-oligonukleotidu na jeden gen několik prób

8 Affymetrix technologie každé místo próby je obsazeno 22 oligonukleotidy reprezentující jeden gen 11 z nich je tzv.perfect match (PM) přesně kopírují sekvenci genu 11 z nich je mismatch (MM) liší se jedním nukleotidem v centrální pozici ( ) např. U133A human array, obsahuje přes různých sekvencí (genů) které jsou reprezentovány zhruba v oligonukleotidech

9 PM - 25 bazí komplementárních k referenční sekvenci MM – prostřední báze je odlišná Affymetrix GeneChips vymezení DNA próby pairs vzorek mRNA 5’3’ referenční sekvence genu … TGTGATGGTGGGAATGGGTCAGAAGGGACTCCTATGTGGGTGACGAGGCC… TTACCCAGTCTTCCCTGAGGATACAC TTACCCAGTCTTGCCTGAGGATACAC Perfect match oligo Mismatch oligo PM MM PM MM Probe Pair PM Probe Cell Probe Set

10 Affymetrix technologie značení mRNA populace Cy3-dCTP Cy5-dCTP

11

12 Affymetrix technologie značení mRNA populace cy3 cy5 cy3 cy5 664 nm 510 nm emission cy3 and cy5: běžně používané fluorescenční značky yellow cy3=cy5 red cy5>cy3 green cy3>cy5

13 Affymetrix technologie

14 Agilent bioanalyzer

15 Affymetrix technologie PM MM po promytí dvěma různýma populacemi mRNA se zeleným a červeným značením je celá array skenována a vyhodnocena ve speciálních programech nejdřív se vyhodnotí rozdíl mezi PM a MM (tím se velmi redukuje chyba) MM próby vychytávají nespecifický signál následně se srovnají vzájemně intenzity v ideálním případě by dvě naprosto totožné populace mRNA dávali celou žlutou array

16 Affymetrix technologie

17

18 tento komerční genový čip obsahuje 5 arrayi Array B,C,D,E obsahují 4x cca prób pro klustry komprimované z lidských EST klonů array A obsahuje cca prób pro lidské geny o známé funkci tento čip obsahuje genetickou informaci ze dvou organismů Saccharomyces cerevisiae a Schizosaccharomyces pombe čip obsahuje próby pro 5,841 z 5,845 všech genů přítomných v S.cerevisiae a 5,021 z 5,031 genů přítomných v S. pombe. divergence mezi oběma kvasinkami proběhla zhruba před 500 milióny lety a proto je mezi nimi taková odlišnost, která vyžaduje samostatné próby. informace z obou genomů je ale uložena pouze v jednom arrayi. Sekvence pro navržení prób byly vygenerovány z veřejných databázi GenBank® (květen 2004) a Sanger Center (červen 2004)

19 další typ genového čipu jednotlivé array jsou rozděleny podle orgánu ze kterého byl získán daný ESTBrain67,679Heart9,400 Liver37,807 Colon4,832 Prostate7,971 Skin3,043 Bone4,832 Lung20,224 Brain Lung Liver Liver Tumor

20 vznikají i čipy pro organismy, které nemají odsekvenovaný genom např. Affymetrix čip pro ječmen (srpen 2004) přes prób z toho známých genů (včetně alel) z databázi bylo extrahováno zhruba ječmenných EST klonů, ty byly počítačově zpracovány a bylo vytvořeno kontigů a singletonů všechny tři zdroje byly znova zpracovány a bylo vybráno jedinečných genů či jejich fragmentů s kompaktním 3´koncem pro vytvoření prób Potencionální využití studium kvality sladu, kontrola proti škůdcům a nemocem, abiotický stres, nutriční charakteristika

21 cena největší problém (2OO2)

22 využití genových čipů Studium exprese genů (regulace genů) Funkce nových genů (neobjevené metabolické pochody) Detekce mutantů Diagnóza nemocí (analýza polymorfismu) Hledání nových léčebných postupů (jestli určitý druh rakoviny zvyšuje expresi daných genů, můžeme zjistit které další podmínky způsobují expresi těchto genů a případně zjistit, která látka ji zpětně snižuje - potenciální lék) Farmakogenomika (testování nových léčiv před uvedením na trh) Toxikogenomika (hledání korelace mezi odpovědi na toxickou látku a změny jí vyvolané v genetickém profilu)

23 studium exprese genů

24 ZMĚNY V EXPRESI GENů VYVOLANÉ KOUŘENÍM transcriptony z buňek plicního epitelu nekuřáků, kuřáků, bývalých kuřáků a kuřáku různých ras a věku byly izolovány a podstoupeny hybridizaci z GeneChip® U133A NEKUŘÁCI. Bylo zjištěno že v jejich buňkách se exprimuje cca 2,000 genů Exprese těchto genů není ovlivněna věkem, rasou ani pohlavím Většina genů tvoří geny spojené z oxidativním stresem, ion/elektronové přenašeče, chaperony, vezikulární transportery atd. KUŘÁCI. Zvýšená exprese 97 genů – spojené s buněčnou adhezí, oxidativním stresem, metabolismem gluthationu, transportem elektronů, metabolismem a sekrecí xenobiotik a několik onkogenů Downregulovány byly supresory tumorů a zánětové regulátory. Profil tři dlouhodobých kuřáků stejný jako u nekuřáku !!! Profil daleko výraznější u starších kuřáků Pohlaví nemá vliv, rasa ano Kavkazská rasa daleko slabší profil než negroidní BÝVALI KUŘÁCI. Návrat k normální expresi do dvou let Stále vysoká hladina supresorů tumorů a některých onkogenů VÝZNAM. Objeveno spousta genů které nebyly s kouřením spojovány (metabolismus gluthationu) Dají se identifikovat kuřáci s vysokým rizikem ke vzniku rakoviny plic

25

26 pro diagnostické účely se budou používat čipy s limitovaným počtem prób (metoda bude daleko levnější)- prediktivní medicína Affymetrix technologie je značně spolehlivá (při testování 34 stejných vzorků byla 94-97% shoda). DNA biočipy jsou považovány za nejobjevnější genetický nástroj poslední dekády PROBLÉMY GENOVÝCH ČIPů: množství mRNA není vždy úměrné množství proteinuznalost sekvence genu a míry její exprese mnohdy nestačí k předpovězeni povahy a množství proteinu jí kódovaného (množství mRNA není vždy úměrné množství proteinu) alternativní splicing – jeden gen produkuje více proteinů syntéza proteinů je ovlivněna i vnějšími vlivy a může se lišit i v čase význam proteomiky

27 obrana proti bioterorismu biologická válečná agens jsou bez barvy a bez zápachu a většinou trvá dny až týdny než vyvolají symptomy

28 obrana proti bioterorismu nejnovější detektory biologických zbraní dokážou odlišit patogeny od neškodných organismů tím,že srovnávají jejich genetickou výbavu systém GeneXpert nebo(americká firma Cepheid) obsahuje koncentrátor vzduchu a filtr zachycující patogeny dezintegrátor buněk DNA patogenů pak jde do speciálního čipu obsahující ssDNA ze všech možných pathogenů, který má po stranách elektrody čip se pak hybridizuje s krátkými komplementárními próbami značenými zlatými částečkami pokud dojde k hybridizaci sepne se pomocí zlatých částeček obvod jiný typ detektoru je založen na real-time PCR databáze TIGER triangulační genetická evaluace biologických rizik amplifikace úseku genomu odpovědného za proteosyntesu, nelze zneužít mutací patogena

29 Swiss Federal Institute for Technology sledování exprese 23,750 genů u modelové rostliny Arabidopsis thaliana v jednotlivých orgánech a v závislosti na ontogenezi, a biotických a abiotických faktorech proč Arabidopsis? genů zhruba u 60% je předpovězena nebo objasněná funkce databáze zpracovává data z 2317 arrayí (listopad 2005)

30

31


Stáhnout ppt "Genové čipy. co to je genový čip (DNA microarray)? DNA šikování nová technologie zavedená koncem devadesátých let geny nebo fragmenty genů (cDNA, EST)"

Podobné prezentace


Reklamy Google