Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Možnosti identifikace osoby prostřednictvím analýzy DNA.

Podobné prezentace


Prezentace na téma: "Možnosti identifikace osoby prostřednictvím analýzy DNA."— Transkript prezentace:

1 Možnosti identifikace osoby prostřednictvím analýzy DNA

2 MALÉ REVIEW

3 INDIVIDUALITA V čem tkví genetická jedinečnost?

4 INDIVIDUALITA V čem tkví genetická jedinečnost?

5 INDIVIDUALITA V čem tkví genetická jedinečnost?

6 90% nekódující sekvence 10% kódující sekvence a spol. méně než 50% jedinečné sekvence přes 50% repetitivní sekvence

7 Genes and gene- related sequences Genes and gene- related sequences Extragenic DNA Extragenic DNA Nuclear genome 3000 Mb genes Mitochondrial genome 16.6 kb 37 genes Coding DNA Coding DNA Noncoding DNA Noncoding DNA Unique or low copy number Unique or low copy number Moderate to highly repetitive Moderate to highly repetitive Pseudogenes Gene fragments Introns, untranslated sequences, etc. Introns, untranslated sequences, etc. Tandemly repeated or clustered repeats Tandemly repeated or clustered repeats Interspersed repeats Interspersed repeats Unique or moderately repetitive Two rRNA genes Two rRNA genes 22 tRNA genes 22 tRNA genes 13 polypeptide- encoding genes 13 polypeptide- encoding genes 30%70% 10% 90% 80% 20%

8 ROSTE S: mutační rychlostí lokusu (HOT SPOTS) stářím lokusu evoluční výhodou variability (pozitivním selekčním tlakem na nové mutace) (např. HLA) KLESÁ S: účinností reparačních mechanismů (nDNA vs. mtDNA) negativním selekčním tlakem na nové mutace (GENY)

9

10 LINESINEVNTRSTR krátký motiv dlouhý motiv rozptýlené tandemové

11 Rozptýlené repetitivní sekvence Většina rozptýlených repetic má původ v transpozibilních elementech DNA transpozony Retrotranspozony gen pro transpozázu + na obou koncích invertovaná repetitivní sekvence (vzniká útvar stopka-očko) mechanismus cut´n´paste (jako při zrání imunoglobulinů a TLR) u lidí už neaktivní (mutace), ale…!!! pro skákání používají buněčné RNA polymerázy mechanismus copy´n´paste u lidí aktivní, tvoří přes 45% genomu, aktivní je jen každá cca 100 kopie (mutace) jsou buď autonomní (kódují potřebné proteiny), nebo neautonomní (využívají proteinový aparát jiných transpozónů)

12 LTR retrotranspozony – endogenní retroviry připomínají svým složením proviry skutečných retrovirů obsahují LTR (long terminal repeats, dlouhé terminální repetice) a geny gag, pol, env a prt alespoň jeden z genů nezbytných pro sestavení infekčních virových částic je mutován nebo chybí → mohou se pohybovat pouze uvnitř buněk životní cyklus podobný infekčním retrovirům jako je HIV lidský genom v současné době obsahuje pouze fosilie endogenních retrovirů – cca 8% genomu Intaktní endogenní retroviry dlouhé 7-9 kb, ale také mnoho zkrácených často lze najít pouze samostatné LTR

13 non-LTR retrotranspozony autonomní retrotranspozóny cca 21% lidského genomu rozeznáváme různé rodiny – LINE1 (L1), LINE 2, LINE 3 … LINE1 jsou aktivní (17% genomu) – kopií, z toho cca 100 stále schopno transpozice aktivní element L1 je dlouhý cca 6 kb obsahuje ORF1 (?) a ORF2 (reverzní transkriptáza) LINE = long interspearsed nuclear elements

14 neautonomní retrotranspozony typicky kratší než 500 bp nejpočetnější rodinou jsou Alu repetice Alu mohou být náhodně aktivní (11% genomu) – kopií obsahují sekvenci 282 bp - patrně odvozena z RNA podjednotky SRP (7SL RNA) SRP = signal recognition particle - ribonukleoproteinový komplex - rozpoznává signální peptid, váže se na něj a přemístí komplex ribozom-mRNA-nascentní peptid ke kanálu endoplazmatického retikula (ER), skrz nějž je nascetní peptid translokován do lumenu ER nebo integrován v membráně ER Alu se tak může vázat na ribozom a díky svému "ocasu" bohatému na adenin také (pokud ribozom zrovna zpracovává LINE-1 mRNA) na nascentní protein ORF2 a zneužít ORF2 k reverzní transkripci a integraci vlastní RNA a nikoli LINE-1 SINE = short interspearsed nuclear elements

15

16 funkce transpozónů junk DNA, selfish DNA… ze širšího hlediska – důležitá role – zvyšuje plasticitu genomu vyřazení genu z provozu změna exprese genu transpozice jinak netranspozibilních elementů (svezou se) indukce delecí, inverzí geny odvozené z transpozónů podpora mezichromozomového nerovnoměrného crosing-overu nebo intrachromozomové rekombinace uvažuje se o tom, že by transpozony mohly mít nějakou reálnou fyziologickou funkci, např. proto, že jejich exprese je obecně zvýšena během stresové odpovědi

17 tandemově repetitivní sekvence VYSOCE REPETITIVNÍ NÍZCE REPETITIVNÍ rRNA, tRNA a histonové geny α-satelity minisatelity = VNTR mikrosatelity = STR SINGLE COPY SEKVENCE

18 α- satelitní DNA primární jednotka dlouhá 171 bp tvoří funkční jádro centromery některé proteiny kinetochory se váží na alfa satelit v centromeře a tím zahajují sestavování kinetochory

19 minisatelitní DNA = LTR (dlouhé tandemové) primární jednotka (motiv) dlouhá řádově desítky bazí – vzniká z mikrosatelitů více se vyskytují v subtelomerických oblastech chromozómů lze sem zařadit i cíleně vznikající TTAGGG repetice v oblasti telomer

20 VNTR – co to je? VNTR (Variable Number of Tandem Repeats) označuje vlastně obecně jev, na němž byly založeny první identifikace, tj. existenci variability počtu opakování motivu v repetici tyto první testy prováděl Alec Jeffreys

21 VNTR Jeffreys studoval gen pro myoglobin zjistil, že v jednom z intronů je repetitivní sekvence rozhodl se ji studovat tak, že vytvoří specifickou sondu, provede restrikci a vzniklou směs fragmentů bude hybridizovat se sondou sonda však nenašla jen jedno, ale celou řadu cílových míst – vznikl hybridizační vzor Jeffreys zjistil, že tento vzor je různý u různých osob způsob, jak zobrazit jedinečnost genomu, byl objeven

22 metoda se nazývá RFLPs DNA je inkubována s restriktázou Mnoho možností, které restriktázy užít (i kombinace více restriktáz) DNA lze poté zviditelnit s použitím specifické sondy – výsledný hybridizační obraz je u různých osob různý (Restriction Fragment Length Polymorphisms) Délkový i sekvenční polymorfismus!!!

23 RFLP: Elektroforéza

24 RFLP: Autoradiogram

25 Jak jedinečné tyto obrazce jsou? The probability of 2 people having exactly the same DNA profile is between 1 in 5 million to 1 in 100 billion (greater than the population of humans on earth) This number becomes even larger if you consider more regions of DNA Thus, the odds that the DNA evidence from a crime scene will match your DNA profile is astronomically small (unless you have an evil identical twin) Těžko říct…

26 mikrosatelitní DNA = STR primární jednotka (motiv) dlouhá řádově jednotky bazí (do 10 bp) počet opakování motivu v jednom lokusu řádově jednotky až stovky nejčastější jsou dinukleotidové (CA) n po celém genomu, ve valné většině mimo geny, ale jsou výjimky onemocnění z expanze trinukleotidových repetic Huntingtonova chorea huntingtin - repetitivní sekvence (CAG)n v exonu kóduje úsek bílkoviny tvořený zbytky glutaminu doména pro interakce s jinými proteiny normálně do 20 Glu, nad 30 Glu začíná problém myotonická dystrofie DMPK - repetitivní sekvence (CTG)n v nepřekládané 3´části genu při expanzi je mRNA patogenní – sekvestrace (odlučování) transkripčních faktorů

27 mají STR nějakou funkci? možná ano…! mnoho indicií, žádné nezvratné důkazy… některé dinukleotidy asi spojeny s regulací genové exprese (jsou před promotorem) některé dinukleotidy asi fungují jako rekombinační hot-spoty některé ale asi opravdu k ničemu

28 klasifikace STR mono--AAAAAA- di--TATATA- tri--TACTAC- tetra--GAGCGAGC- … dle délky motivu: dle stavby motivu: perfect- CACACACACACACACACACA – imperfect- CACACACACACTCACACACA – interrupted- CACACACAGTTCCACACACA – composite- CACACACACACTCTCTCTCT –

29 názvosloví STR lokusy triviální FGA (located in the third intron of the human alpha fibrinogen gene) vWA (von Willebrand Factor, 40th intron) TH01 (intron 1 of human tyrosine hydroxylase gene) TPOX (human thyroid peroxidase gene), CSF1PO (human c-fms proto-oncogene for CSF-1 receptor gene) SE33 (β-actin related pseudogene) Penta D (21q22.3) Penta E (15q26.2) LPL (intron 6 of the lipoprotein lipase gene) polotriviálníY-GATA-H4 systematickéD21S11 DYS390

30 názvosloví STR alely označují se číslem, které vyjadřuje počet opakování základního motivu alela 7 v lokusu TH01: [AATG] 7 alela 9 v lokusu TH01: [AATG] 9 alela 9.3 v lokusu TH01: [AATG] 6 ATG[AATG] 3 jedno označení může zahrnovat více sekvencí alela 7 [AATG] 6 [AAAG] [AATG] 4 [AAAG] [AATG] 2 tzv. MIKROVARIANTA

31 STR – jak vlastně vznikají nové alely? vysoká mutační rychlost: to nt / lokus / generace asi dva základní mechanismy – nerovnoměrný crossing over a chyba při replikaci tímto mechanismem vznikají i alely s „tečkou“ = neúplné (9.3)

32 +n-n

33

34 kde najdeme v lidském genomu STR ?

35 Dědičnost STR – autozomální STR klasická mendelovská dědičnost homozygozita a heterozygozita STR lokus, např. TH01 9 / 9 6 / 9.3

36 Dědičnost STR – autozomální STR / 9 8 / 98 / 96 / 108 / 10

37 Dědičnost STR – X-STR nonmendelovská dědičnost homozygozita a heterozygozita u žen, hemizygozita u mužů STR lokus 21 / / 22 STR lokus 22

38 Dědičnost STR – X-STR 22Y / 21 Y / 2122 / 24Y / 24 XXXY

39 Dědičnost STR – Y-STR nonmendelovská dědičnost jedna kopie lokusu u mužů STR lokus není STR lokus 22

40 Dědičnost STR – Y-STR X 22 X X / X 22 / X XXXY

41 SNADNO A RYCHLE

42 Analýza STR je založena na PCR POMOCÍ SEKVENČNĚ SPECIFICKÉHO PÁRU PRIMERŮ AMPLIFIKUJI FRAGMENT OBSAHUJÍCÍ DANOU REPETICI

43 Analýza STR je založena na PCR konstantní sekvence REPETICE Fragment má délku podle počtu opakování motivu v repetici (např. 160 – 204 bp) S celkovým rozpětím délek můžu šoupat podle toho kam umístím primery 160 – 204 bp 240 – 284 bp

44 Cca polovina vzniklých fragmentů bude mít tudíž začleněnou fluorescenční barvičku Při PCR nepoužijeme obyčejné primery, ale jeden v páru je vždy fluorescenčně značený

45 Barvičky mohou emitovat v různých oblastech spektra chci od nich, aby: byly chemicky stabilní velmi dobře emitovaly byly fotostabilní (emitovaly bez problémů opakovaně)

46 Provedu elektroforézu a detekci fluorescenční barvičky Hitachi FMBIO IIApplied Biosystems 310, 3100 kapilární elfogelová elfo

47 DNA samples are loaded onto a polyacrylamide gel STR alleles separate during electrophoresis through the gel Sample Separation Sample Detection (Post-Electrophoresis) 505 nm scan to detect fluorescein-labels 585 nm scan to detect TMR-labels

48 Mixture of dye-labeled PCR products from multiplex PCR reaction Sample Separation Sample Detection CCD Panel (with virtual filters) Argon ion LASER (488 nm) Color Separation Fluorescence ABI Prism spectrograph Capillary Sample Injection Size Separation Processing with GeneScan/Genotyper software Sample Interpretation

49 Kapilární elfo

50

51

52

53

54 ISS = vnitřní standard = „vnitřní žebříček“ 100bp 150bp 160bp 200bp 250bp 139bp X bp Y bp A B

55 různé ISS GS500 ROX (Applied Biosystems) LTI ROX (Life Technologies) ILS600 CXR (Promega)

56

57 160 bp200 bp = bp 8 = bp 9 = bp 10 = bp 11 = bp 12 = bp 13 = bp A = bp = 8 B = bp = 11 AB 160 bp200 bp allelic ladder = vnější standard = „vnější žebříček“

58 alelický ladder konkrétního lokusu interní ladder celé elektroforézy

59 ? ? off-ladder alely

60 Výsledek analýzy jednoho lokusu heterozygot 16/17homozygot 16/16

61 analýza více lokusů najednou = multiplex PCR ale ve skutečnosti je to peklo: primery se nesmí lepit = nesmí být komplementární primery musí mít stejnou anelační teplotu primery musí mít stejné pracovní prostředí amplifikace všech lokusů musí být stejně účinná amplifikuji několik STR více páry primerů najednou (jak prosté, že?) jak ale pak při elektroforéze poznám, který fragment patří do kterého lokusu???

62 rozlišení fragmentů I. = pomocí dye

63 rozlišení fragmentů II. = pomocí délkových rozsahů 160 – 204 bp 240 – 284 bp 160 – 204 bp240 – 284 bp

64 rozlišení fragmentů III. = pomocí modifikátorů mobility 160 – 204 bp 190 – 254 bp 215 – 279 bp Lokus A Lokus B Výhoda – nemusím složitě vylaďovat multiplexy s novými primery

65 Komerční kity - Identifiler D3S1358D16S539 VWA AMEL D8S1179 D21S11 D18S51 D19S433 D5S818 FGA D2S1338 TPOX TH01D13S317 CSF1POD7S820

66 Komerční kity - PowerPlex ® 16 D3S1358 D16S539 VWA D8S1179 D21S11 D18S51 FGA Penta D TPOX D13S317 CSF1PO D7S820 AMEL Penta E TH01 D5S818

67 Některé nemilé jevy I. stuttering D21S11 D18S51 D8S1179 Stutter Product 6.3% 6.2%5.4% Allele

68 Některé nemilé jevy I. stuttering GATA CTAT 3’5’ 1 23 CTAT Sklouznutí polymerázy GATA 5 4 C TA T Lokus je tím náchylnější, čím kratší je motiv Dinukleotidy mají stuttery a stuttery stutterů Tetranukleotidy mají stuttery do 15% Pentanukleotidy prakticky nestutterují

69 Některé nemilé jevy II. imbalance heterozygota až alelický drop-out

70 Některé nemilé jevy III. Splitting = „upadání adenosinu“ = deadenylace 5’ 3’ Polymerase extension Reverse Primer Forward Primer Polymerase extension 5’ A A (-A form)(+A form) Shoulder peak -A +A Split peak +A -A +A -A

71 Některé nemilé jevy IV. Interlokusová imbalance D19 AMEL D3 D8 VWA TH01 D21 FGAD16D18 D2 D19 AMEL D3 D8VWA TH01 D21 FGA D16 D18 D2

72 Některé nemilé jevy V. mizerná kapilára

73 Některé nemilé jevy VI. mutace v místě pro primer * * alela 6 dropoutuje nevyvážené heterozygotní alely vyvážené heterozygotní alely bez mutace mutace na 3’-konci vazebného místa primeru (dropout) mutace ve středu vazebného místa primeru

74 tři píky D21S11 nejčastěji TPOX a D21S11


Stáhnout ppt "Možnosti identifikace osoby prostřednictvím analýzy DNA."

Podobné prezentace


Reklamy Google