RNA –> protein“">

Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Molekulární genetika I. Molekulární základ dědičnosti.

Podobné prezentace


Prezentace na téma: "Molekulární genetika I. Molekulární základ dědičnosti."— Transkript prezentace:

1 Molekulární genetika I. Molekulární základ dědičnosti

2 Úvod molekulární genetika - studium procesů podmiňujících dědičnost a proměnlivost na molekulární úrovnimolekulární genetika - studium procesů podmiňujících dědičnost a proměnlivost na molekulární úrovni genetická informace (GI) je zakódována v DNA - uložena v J buňky v chromozómechgenetická informace (GI) je zakódována v DNA - uložena v J buňky v chromozómech odhalení genetického kódu (GK) - Watson a Crick (1953) - zlomový objev pro další rozvoj molekulární genetikyodhalení genetického kódu (GK) - Watson a Crick (1953) - zlomový objev pro další rozvoj molekulární genetiky v posledních desetiletích bouřlivý rozvoj MG - projekty:v posledních desetiletích bouřlivý rozvoj MG - projekty: HUGO (Human Genome) - mapování lidského genomu HUGO (Human Genome) - mapování lidského genomu BovMap, PigMap, ChickMap BovMap, PigMap, ChickMap

3 Tok genetické informace Exprese genetické informace je komplexní proces a lze si jej představit jako informační tok (přesun informace pomocí informačních molekul z sekvence nukleotidů do sekvence AA) v buňce. Souhrnně tyto procesy (směr "toku" genetické informace) představují tzv. Centrální dogma molekulární genetiky: “DNA –> RNA –> protein“

4 Nukleové kyseliny DNA = deoxyribonukleová k. (deoxyribonucleic acid) (deoxyribonucleic acid) dvouvláknová - dvoušroubovice Funkce: DNA - nositel GI *) *) u některých virů je nositelem GI: RNA - např. medicínsky důležité viry: - např. medicínsky důležité viry: - virus chřipky - virus chřipky - virus HIV (Humane Immunodeficiency Virus) - vyvolává AIDS - virus HIV (Humane Immunodeficiency Virus) - vyvolává AIDS RNA = ribonukleová kyselina (ribonucleic acid) (ribonucleic acid)jednovláknová RNA - podíl na realizaci GI chromozómy se skládají z řady makromolekul: - cca 60–90 % tvoří zhruba ve stejném poměru DNA a histony (bázické proteiny), - cca 60–90 % tvoří zhruba ve stejném poměru DNA a histony (bázické proteiny), - dále nehistonové proteiny a molekuly RNA - dále nehistonové proteiny a molekuly RNA

5 DNA

6 Struktura NK - pětiuhlíkatá ribóza (v RNA) - deoxyribóza (v DNA) - deoxyribóza (v DNA) na 3. a 5. atomu uhlíku na 3. a 5. atomu uhlíku fosfátová skupina fosfátová skupina spojuje molekuly cukru navzájem do řetězce spojuje molekuly cukru navzájem do řetězce na 1. atomu uhlíku cukru na 1. atomu uhlíku cukru - purinové A, G - purinové A, G - pyrimidinové báze T, C - pyrimidinové báze T, C - DNA: A, T, G, C - DNA: A, T, G, C - RNA: A, U, G, C - RNA: A, U, G, C nukleotid X nukleosid pětiuhlíkatý cukr + fosfátová skupina + dusíkatá báze báze + deoxyribóza Základní stavební kamen NK: nukleotid = cukr + fosforečný zbytek + dusíkatá báze

7 Cukerná složka Zbytek H 3 PO 4 u RNA u DNA

8 Dusíkaté báze Purinové adenin A guanin G adenin A guanin G Pyrimidinové thymin T cytosin C uracil U thymin T cytosin C uracil U

9 Nukleotid

10 Řetězec nukleotidů 3´- 5´ V DNA - dva protisměrné nukleotidové řetězce: řetězce: 1. ve směru 5´- 3´ „dolů“ („po směru“) 2. 3´- 5´ „nahoru“ („proti směru“) navzájem jsou spojeny do dvoušroubovice prostřednictvím vodíkových můstků mezi komplementárními bázemi A - T (2 můstky) A - T (2 můstky) a G - C (3 můstky). a G - C (3 můstky).

11 DNA Strukturu DNA můžeme přirovnat k točitým schodům, jejichž "bočnice" jsou tvořeny spojením cukr - fosfátová skupina (monotónně se opakuje). Poloviny jednotlivých stupňů jsou tvořeny dusíkatou bází, která se napojuje na druhou polovinu - komplementárního partnera ze druhého vlákna.

12 Komplementarita bází A - T DNA A - U RNA A - T DNA A - U RNA C - G C - G C - G C - G Příklad komplementarity: 1. vlákno 1. vlákno 2. vlákno 2. vlákno AGTCAGTCTCAGTCAGAGTCAGTCTCAGTCAGAGTCAGTCTCAGTCAGAGTCAGTCTCAGTCAG

13 RNA Typy RNA: 1. transferová (tRNA) - přenos aktivovaných AA na místo biosyntézy bílkovin (ribozómy) biosyntézy bílkovin (ribozómy) 2. ribosomální (rRNA) - součást ribozómů, které jsou místem biosyntézy bílkovin místem biosyntézy bílkovin 3. mediátorová (mRNA) - přenos GI z DNA na bílkoviny (messenger = poslíček) (ve formě specifické sekvence (messenger = poslíček) (ve formě specifické sekvence nukleotidů) nukleotidů) - různá délka (několik set až tisíc - různá délka (několik set až tisíc nukleotidů) nukleotidů)

14 t-RNA Transferová RNA - tvar připomínající trojlístek

15 rRNA mRNA rRNA mRNA

16 Rozdíly mezi DNA a RNA DNA deoxyribóza deoxyribóza A, T, G, C A, T, G, C dvouvláknová dvouvláknová 1 typ DNA *) 1 typ DNA *) stejná fce **) stejná fce **) *) u všech živých organismů **) uchovávání a přenos GI RNA ribóza ribóza A, U, G, C A, U, G, C ± 1vláknová ± 1vláknová 3 typy RNA 3 typy RNA rozličné fce rozličné fcecukrbáze počet vláken počet typů funkce funkce

17 Přenos GI DNA RNA Protein

18 Replikace, transkripce, translace

19 Replikace DNA Struktura ve formě dvoušroubovice a komplementarita bází umožňují semikonzervativní replikaci DNA - z 1 mateřské dvoušroubovice DNA → 2 dceřinné (každá z nich 1 vlákno původní - mateřské a 1 nově syntetizované).Struktura ve formě dvoušroubovice a komplementarita bází umožňují semikonzervativní replikaci DNA - z 1 mateřské dvoušroubovice DNA → 2 dceřinné (každá z nich 1 vlákno původní - mateřské a 1 nově syntetizované). Replikace je zajišťována DNA polymerázami.Replikace je zajišťována DNA polymerázami. Replikační vidlička - místo, kde probíhá syntéza nového vláknaReplikační vidlička - místo, kde probíhá syntéza nového vlákna Dvoušroubovice DNA se rozpojí, každé vlákno je předlohou pro vznik komplementárního vlákna DNA. Postupně jsou na nově vznikající vlákno připojovány nukleotidy, které mají dusíkatou bázi komplementární k bázi na původním vláknu DNA.Dvoušroubovice DNA se rozpojí, každé vlákno je předlohou pro vznik komplementárního vlákna DNA. Postupně jsou na nově vznikající vlákno připojovány nukleotidy, které mají dusíkatou bázi komplementární k bázi na původním vláknu DNA. Syntéza probíhá v obou směrech, obě replikační vidličky se od sebe vzdalují a vytvářejí tak útvar, který je možné pozorovat v elektronovém mikroskopu jako replikační bublinu.Syntéza probíhá v obou směrech, obě replikační vidličky se od sebe vzdalují a vytvářejí tak útvar, který je možné pozorovat v elektronovém mikroskopu jako replikační bublinu. V prokaryontních buňkách je DNA syntetizována jako jednotka, tj. celý chromozóm je jeden replikon, v eukaryontních je rozčleněna do více částí - replikonů.V prokaryontních buňkách je DNA syntetizována jako jednotka, tj. celý chromozóm je jeden replikon, v eukaryontních je rozčleněna do více částí - replikonů. Replikace probíhá v S fázi buněčného cyklu.Replikace probíhá v S fázi buněčného cyklu.

20 Schéma replikace

21

22 Replikon

23 Transkripce podle předlohy v DNA syntetizována RNApodle předlohy v DNA syntetizována RNA 1 mechanismus transkripce pro všechny RNA1 mechanismus transkripce pro všechny RNA Přepisována, transkribována je sekvence nukleotidů v DNA, podle které vzniká komplementární sekvence nukleotidů v RNA.Přepisována, transkribována je sekvence nukleotidů v DNA, podle které vzniká komplementární sekvence nukleotidů v RNA. Tento proces je enzymaticky zajišťován RNA polymerázami.Tento proces je enzymaticky zajišťován RNA polymerázami. Signální sekvence DNA před genem, na které se váže RNA polymeráza se nazývá promotor. Na promotor se naváží transkripční faktory (proteiny), dále RNA polymeráza a za přítomnosti volných ribonukleotidů probíhá syntéza nového řetězce mRNA.Signální sekvence DNA před genem, na které se váže RNA polymeráza se nazývá promotor. Na promotor se naváží transkripční faktory (proteiny), dále RNA polymeráza a za přítomnosti volných ribonukleotidů probíhá syntéza nového řetězce mRNA. Produktem transkripce je prekurzorová pre-mRNA (kromě vlastního genu obsahuje také introny a okrajové části genu) → maturace (dozrávání) mRNA - dojde k enzymatickému rozštěpení pre-mRNA a spojení exonů (kódujících částí). Introny (nekódující části) zůstávají v jádře. Tento proces se nazývá splicing (=sestřih).Produktem transkripce je prekurzorová pre-mRNA (kromě vlastního genu obsahuje také introny a okrajové části genu) → maturace (dozrávání) mRNA - dojde k enzymatickému rozštěpení pre-mRNA a spojení exonů (kódujících částí). Introny (nekódující části) zůstávají v jádře. Tento proces se nazývá splicing (=sestřih).

24 Schéma transkripce

25 Posttranskripční úpravy po ukončení transkripce - vznik pre-mRNA => zrání (maturace) pre-mRNA - 2 typy úseků: exony a introny pre-mRNA - 2 typy úseků: exony a introny SPLICING = sestřih - „vystřižení“ intronů SPLICING = sestřih - „vystřižení“ intronů Schéma splicingu

26 Translace = přepis informace o sekvenci nukleotidů v mRNA do sekvence AA (aminokyselin) ve vznikajícím proteinu (překlad nukleotidů do pořadí AA v polypeptidovém řetězci)= přepis informace o sekvenci nukleotidů v mRNA do sekvence AA (aminokyselin) ve vznikajícím proteinu (překlad nukleotidů do pořadí AA v polypeptidovém řetězci) probíhá na ribozómech (komplex několika typů rRNAprobíhá na ribozómech (komplex několika typů rRNA a proteinů) a proteinů) volné AA jsou vázány na tRNA, transportovány do ribozómu, kde tRNA nasedá svým antikodonem (specifická trojice bází) na kodon na mRNAvolné AA jsou vázány na tRNA, transportovány do ribozómu, kde tRNA nasedá svým antikodonem (specifická trojice bází) na kodon na mRNA pořadím tří bází na kodonu je dána AA, která bude na příslušném místě v syntetizovaném proteinupořadím tří bází na kodonu je dána AA, která bude na příslušném místě v syntetizovaném proteinu na sousední kodon nasedá další tRNA s AA, mezi aminokyselinami vzniká peptidová vazba, dále ve směru 5´- 3´ nasedají další tRNA a navazují se další AAna sousední kodon nasedá další tRNA s AA, mezi aminokyselinami vzniká peptidová vazba, dále ve směru 5´- 3´ nasedají další tRNA a navazují se další AA

27 Schéma translace

28 Translace

29

30 Genetický kód - soubor pravidel, podle kterých se genetická informace uložená v DNA, resp. RNA, převádí na primární strukturu bílkovin - tj. pořadí v DNA, resp. RNA, převádí na primární strukturu bílkovin - tj. pořadí aminokyselin v řetězci aminokyselin v řetězci Vlastnosti - GK je: 1. tripletový - pořadí tří nukleotidů určuje aminokyselinu - trojice bází kóduje 1 AA (trojice nukleotidů = kodon, triplet) kóduje 1 AA (trojice nukleotidů = kodon, triplet) 2. univerzální - u všech organismů kóduje 1 a ten samý triplet stejnou AA (pravidlo platí pro velkou většinu kodonů, AA (pravidlo platí pro velkou většinu kodonů, u některých organismů mají některé kodony odlišný u některých organismů mají některé kodony odlišný smysl) smysl) 3. degenerovaný (nadbytečný) - 1 AA může být determinována více kodony (1 AA je kódována více kodony (1 AA je kódována více triplety) triplety) 4. bez mezer a nepřekrývající se - jednotlivé kodony v molekule NK následují bezprostředně za sebou

31

32 Ze tří různých bází v kodonu je možné sestavit celkem 64 kombinací !

33 Gen = úsek DNA, která má: 1. specifickou funkci v buňce a v celém organismu - musí být schopen utvářet dědičný znak nebo spolupracovat při utváření několika takovýchto dědičných znaků 2. je schopen vytvářet přesné vlastní kopie - přenášet svou funkci z generace na generaci 3. charakteristickou vlastností genu je schopnost náhle změnit svou strukturu a tím i funkci, tj. podléhat mutacím. Zmutovaný gen replikuje svou změněnou podobu. Lokus - místo na chromozomu, na kterém je gen umístěn Alely - odlišné formy téhož genu, které u různých jedinců téhož druhu alterují na jednom lokusu (uspořádání lokusů je pro druh konstantní)

34 Gen 1) Strukturní gen - úsek DNA, který je přepisován do primární struktury polypeptidu: Strukturní gen - transkripce - mRNA - translace - polypeptid. 2) Gen pro funkční RNA - úsek DNA, který je přepisován do tRNA, rRNA nebo jiného typu RNA, avšak neprobíhá podle něj translace. 3) Gen jako regulační oblast - úsek DNA, identifikovaný specifickým proteinem, který zahajuje nebo zastavuje transkripci. Podle regulační oblasti se tedy netvoří žádný produkt, ani RNA, ani polypeptid. Struktura genomu U eukaryot je DNA: v jádře buňky v chromozomech, v mitochondriích (živočiš. buňky), v chloroplastech (rostlinné buňky). Mimojaderné geny však hrají v eukaryontní buňce významnou roli, u rostlin probíhá v chloroplastech fotosyntéza, u živočichů v mitochondriích oxidázový cyklus.

35 II. Molekulárně genetické metody - úvod

36 Využití MG metod Na úrovni lidské DNA: Na úrovni DNA nebo RNA bakteriálních nebo virových infekčních agens: - identifikace sekvence podmiňující vznik dědič. onemocnění - určování genetické identity jedinců - určování parentity (rodičovství) - průkaz původu biol. materiálu v soudním lékařství apod. - rychlá detekce - využití v klinických vzorcích - nahrazení zdlouhavého testování původce onemocnění na základě až vytvořených protilátek (ELISA test)

37 Metoda PCR - metoda polymerázové řetězové reakce (PCR) (polymerase chain reaction): - r Saiki a Mullis - Nobelova cena - umožňuje namnožit DNA nebo její fragmenty do množství potřebného pro diagnostické účely

38 Principy molekulárně genetické diagnostiky Izolace nukleových kyselin - základem odstranění proteinů, které tvoří - základem odstranění proteinů, které tvoří s DNA komplex s DNA komplex (fenol-chloroformová extrakce, vysolení, působnost různých enzymů apod.) (fenol-chloroformová extrakce, vysolení, působnost různých enzymů apod.) Diagnostika NK / fragmentů NK / fragmentů NK -podstata: rozštěpení DNA na fragmenty (restrikčními enzymy) a jejich následná identifikace (např. s využitím Southernova přenosu, PCR a jejích modifikací apod.) (např. s využitím Southernova přenosu, PCR a jejích modifikací apod.)

39 Molekulárně genetická diagnostika dědičných chorob Lidský genom -asi genů -každý gen je potenciálně polymorfní - výskyt v různých variantách (alelách) vzniklých mutačním procesem -řada z těchto mutací může vést ke vzniku danou mutací podmíněné choroby Princip přímé a nepřímé MG diagnostiky dědičných chorob: poznání rozdílu v DNA původní a mutované alely a identifikace těchto rozdílů

40 Přímá diagnostika - detekce mutací -metody umožňují identifikovat typ bodové mutace u jejího nositele (podle obrazu na elektroforeogramu) -např. Duchenneova svalová dystrofie

41 Detekce deleční formy Duchenneové svalové dystrofie Fragmenty 3,3, resp. 3,1 kb jsou součástí X-chromozomového genu, který je za toto onemocnění zodpovědný. Postižený syn: 0,8 kb - není přítomný ani u jednoho rodiče, vznikl jako důsledek vnitrogenové delece, která zkrátila restrikční fragment z 3,1 na 0,8 kb. (Ferák a Sršeň 1990) (Ferák a Sršeň 1990)

42 Nepřímá diagnostika - v případech, kdy u pacienta nelze přímo zjišťovat přítomnost mutace, opírá se molekulárně genetická diagnostika o vyšetření polymorfismu charakterizovaném chyběním nebo přítomností cílového místa pro určitý restrikční enzym - nejčastější metodou: metoda polymorfismu délky restrikčních fragmentů - RFLP (restriction fragment lenght polymorphism) - např. diagnostika hemofilie A

43 Výsledek elektroforetické separace restrikč. fragmentů

44 Testování parentity (rodičovství) - dříve: klasické metody - při testování parentity šlo pouze o vyloučení nesprávně uvedeného rodiče, nikoliv o jeho potvrzení - dnes: aplikace MG metod - spolehlivější, výsledkem může být takřka 100% potvrzení rodičovství - využití vysoce polymorfních mikrosatelitních lokusů - např. D1S7 s teoreticky očekávanými 2400 alelami alternujícími na tomto lokusu - > 99% jedinců je na tomto lokusu heterozygotních => shodné genotypy např. více potenciálních otců mají jen nízkou pravděpodobnost incidence

45 Molekulárně genetický důkaz biolog. materiálů a infekčních agens Rozšíření využití PCR —> rychlost, extrémní citlivost - klinická mikrobiologie -virologie -hodnocení kvality potravin -vychází se z průkazu patogenu na základě identifikace jeho druhově specifické sekvence nukleotidů v DNA -pro průkaz patogenu postačí teoreticky 1molekula DNA -obdobné metodiky jsou používány pro rozlišení např. biologických stop krve, sperma, slin, vlasů, epitelií a jiných biologických materiálů v soudním lékařství nebo kriminalistice

46 Druhově specifická amplifikace sekvence DNA pro různé druhy hosp. zvířat a analyzovaný vzorek => identifikovaný vzorek - směs dvou mas

47 Postup při realizaci PCR-RFLP

48 PCR - probíhá inkubací vzorků při třech teplotách odpovídajících třem krokům v amplifikačním cyklu: denaturaci, annealing a elongaci

49 RFLP - pomocí RFLP se identifikují alely na základě přítomnosti nebo absence specifického restrikčního místa -namnožená genomová DNA (PCR produkt) je štěpena příslušnou restrikční endonukleázou a separována pomocí elektroforézy na agarózovém gelu -vizualizace DNA se provádí pomocí ethidiumbromidu -reakční směs pro štěpení PCR produktu: pufr pro restrikční endonukleázu, enzym restrikční endonukleáza a příslušné množství destilované H 2 O, do směsi se přidávají vzorky DNA -teplota inkubace: 37 °C - enzymatické štěpení specifických míst sekvence DNA, které rozpoznává daný enzym -po inkubaci se do jamek v gelu nanese pipetou vzorek - vyhodnotí se fragmenty vzorků podle markeru, tvořící žebříček fragmentů

50 Determinace pohlaví pomocí PCR – vzorek kostí z pohřebiště z 8.-9.stol. (Kolárik a kol., 2002)

51 Hemofilie

52 Huntingtonova chorea

53 Genetický polymorfismus LEP genu prasat pomocí PCR-RFLP (Bábelová a kol., 2002)

54 Genetický polymorfismus ESR genu prasat pomocí PCR-RFLP (Omelka a kol., 2001)

55 Použitá literatura k dispozici u autora.


Stáhnout ppt "Molekulární genetika I. Molekulární základ dědičnosti."

Podobné prezentace


Reklamy Google