Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Genetika mikroorganismů Z latinského genaó = tvořím Přenos genetické informace je základní atribut živé hmoty Základní genetické pochody jsou konzervativní.

Podobné prezentace


Prezentace na téma: "Genetika mikroorganismů Z latinského genaó = tvořím Přenos genetické informace je základní atribut živé hmoty Základní genetické pochody jsou konzervativní."— Transkript prezentace:

1 Genetika mikroorganismů Z latinského genaó = tvořím Přenos genetické informace je základní atribut živé hmoty Základní genetické pochody jsou konzervativní = podobné u všech organismů (společný původ?) Genetická informace je uložená v nukleových kyselinách

2 Nukleové kyseliny Základní nositelky dědičné informace –DNA = deoxirubonukleová kyselina (deoxyribonucleic acid) –RNA = ribonukleová kyselina (ribonucleic acid) Fosfát – pentózová kostra s postranně navázanými bázemi Pořadí bází nese genetickou informaci

3 Nukleové kyseliny PPPPPPPP AG TC TCCT GG AGG CC A P PPPPPPP

4 DNA Deoxyribóza Báze Adenin, Guanin, Cytozin, Thymin Stabilnější Obvykle dvouvláknová (double-stranded = ds) RNA Ribóza Báze Adenin, Guanin, Cytozin, Uracil Méně stabilní Obvykle jednovláknová (single-stranded ss)

5 Báze nukleových kyselin AdeninGuanin CytosinThymin Uracil Purinové báze Pyrimidinové báze

6 Dvouřetězcové NK NK bývají obvykle dvouvláknové = dva samostatné řetězce NK jsou spojené vodíkovými vazbami mezi bázemi Báze se tzv. párují Oba řetězce jsou tzv. komplementární = nesou opačnou genetickou informaci („negativ a pozitiv“)

7 Párování bazí Základ všech genetických pochodů Párování umožňuje předávání a expresi genetické informace Purin (A, G) s pyridinem (T, U, C) 2 nebo 3 vodíkové můstky A = T A = U C ≡ G

8 Šroubovicová struktura Oba řetězce NK se vzájemně obtáčejí = dvojšroubovice Řetězce leží tzv. antiparalelně = konec jednoho leží u začátku druhého („hlava- pata“) –podle popisu struktury pentózy jsou konce vlákna označovány jako 3’- a 5’-

9

10 Párování bazí DNA - DNA 5’- A T T C G G C T T A G G C G - 3’ 3’- T A A G C C G A A T C C G C - 5’ DNA – RNA 5’- A T T C G G C T T A G G C G - 3’ 3’- U A A G C C G A A U C C G C - 5’ RNA – RNA 5’- A U U C G G C U U A G G C G - 3’ 3’- U A A G C C G A A U C C G C - 5’

11 Genetická informace Pořadí bází určuje genetickou informaci Gen = úsek NK kódující nějakou funkci –Strukturní gen – kóduje strukturu bílkoviny –Gen pro RNA – kóduje strukturu RNA Soubor všech genů = genom Kromě genů jsou v NK i další úseky –Regulační (řídící) –Nekódující – bez funkce nebo s neznámou funkcí – evolučně pokročilejší organismy mají více nekódujících sekvencí

12 Genetické pojmy Intron = sekvence DNA nekódující bílkovinu vmezeřená do strukturního genu Sestřih = proces odstraňování intronů ze strukturního genu Promotor = sekvence DNA uvozující gen nebo operon Operon = sekvence několika genů se společnou regulací Kodon = trojice bází kódující jednu aminokyselinu v peptidovém řetězci Antikodon = sekvence tří bazí komplementární ke kodonu

13 Typy RNA mRNA (messanger, mediátorová) = přenos exprimovaných genů z jádra na ribozómy rRNA (ribozomální) = stavební funkce v ribozómech, uplatňují se při translaci tRNA (transferová) = čtení genetického kódu, přenos aminokyselin při syntéze proteinů

14 Základní genetické pochody Replikace (zdvojení) = kopírování genetické informace do nové molekuly NK Transkripce (přepis) = kopírování malé části genetické informace z DNA do RNA Translace (překlad) = syntéza primární struktury bílkoviny podle informace v RNA

15 Základní genetické pochody DNA RNA Bílkovina transkripce reverzní transkripce translace replikace „Základní dogma molekulární biologie“ replikace

16 Replikace Nutná pro předání genetické informace další generaci Enzym DNA polymeráza Rozpletení dsDNA Ke každému vláknu je dosyntetizováno druhé komplementární Semikonzervativní (polovina nové molekuly DNA pochází od rodiče, polovina je nová)

17 Semikonzervativní replikace

18 PPP A T TC AG PP P T A P P PPPP G C CT GG GCCA PPPP A T P P P P P P P P G C C T G G G C C A P P P P A T P P

19 Exprese genů genmRNA transkripcetranslace polypeptid posttranslační modifikace transport Funkční protein Soubor pochodů vedoucích od genu po funkční bílkovinu Možná regulace na všech úrovních

20 Transkripce Přepis jednoho nebo několika genů z DNA do mRNA Enzym RNA polymeráza

21 Reverzní transkripce Pouze u tzv. retrovirů (např. HIV) Přepis z RNA do DNA Enzym reverzní transkriptáza – nekontroluje chyby  mutace Vzniklá DNA je integrována (začleněna) do genomu  může vzniknout rakovina

22 Translace Syntéza bílkovin podle genetické informace Probíhá na ribozómech Ribozóm se posouvá po mRNA a syntetizuje peptid Čtení genetické informace podle genetického kódu mRNA

23 Genetický kód Soubor kódů pro všechny aminokyseliny 20 kódovaných aminokyselin Jedna aminokyselina je kódována třemi bázemi (tzv. triplet nebo kodon) Triplet = 64 kombinací  genetický kód je degenerovaný (více kódů pro jednu aminokyselinu) Genetický kód je univerzální (= až na výjimky stejný ve všech organismech)

24 Genetický kód

25 Čtení genetického kódu 5’- A U U C G G C U U A G G - 3’ N- Ile Arg Leu Arg -C Nukleové kyseliny jsou čteny i syntetizovány od 5’ konce Bílkoviny jsou čteny i syntetizovány od N konce

26 Čtecí rámec 1 aminokyselina je kódována 3 bázemi = záleží na tom, kde se začne číst Čtecí rámec, jsou 3 možné začátky čtení, ale jen jeden je správný 5’- A U U C G G C U U A G G - 3’ N- Ile Arg Leu Arg -C

27 Čtecí rámec 5’- A U U C G G C U U A G G - 3’ N- Ile Arg Leu Arg -C

28 Čtecí rámec 5’- A U U C G G C U U A G G - 3’ N- Ile Arg Leu Arg -C 5’- A U U C G G C U U A G G - 3’ N- Phe Gly Leu -C

29 Čtecí rámec 5’- A U U C G G C U U A G G - 3’ N- Ile Arg Leu Arg -C 5’- A U U C G G C U U A G G - 3’ N- Phe Gly Leu -C 5’- A U U C G G C U U A G G - 3’ N- Ser Ala STOP -C

30 Genomika Genetická informace uložena v DNA U některých virů i v RNA Genomika = věda zabývající se genomy a genetickou informací Velikost genetické informace se udává v párech bazí (base pairs = bp)

31 Velikost genomů OrganismusBp Bakterioág MS23569 Escherichia coli Mycoplasma genitalium Nanoarchaeum equitans Saccharomyces cerevisiae Populus trichocarpa (topol)4, Homo sapiens sapiens (člověk)3, Fritillaria assyriaca1, Amoeba dubia (měňavka)6,

32 Genetická informace Jaderná –Chromózómy = hlavní „velké“ DNA Mimojaderná –Plasmidy = malé kruhové DNA u bakterií –DNA v organelách (mitochondrie, plastidy)

33 Bakteriální genóm Obvykle kruhová DNA Obvykle jeden chromozóm Volně v cytoplazmě DNA obalena alkalickými aminy (spermin a spermidin) Časté plasmidy, i několik desítek Bez intronů Geny uspořádány do operonů

34 Eukaryotický genom Lineární DNA Obvykle více chromozómů (člověk 46) DNA je uložena v jádře obaleném dvojitou membránou Zahuštěna do kompaktní struktury pomocí alkalických bílkovin (histonů) Plasmidy výjimečné Geny mají introny Operony nenacházíme

35 Archeální genóm Mezistupeň mezi bakteriemi a eukaryoty Obvykle lineární Volně v cytoplasmě DNA obalena bílkovinami podobnými eukaryotickým histonům Primitivní introny Plasmidy (méně než bakterie) Geny organizované do operonů

36 Plasmidy Krátké cyklické úseky DNA Výskyt zejména u bakterií V buňce může být i několik stovek plasmidů, stejných i různých Některé plasmidy vzájemně nekompatibilní (nemohou být v jedné buňce) Nezávisle se replikují Občas vymizení

37 Plasmidy Postaru nazývané faktory Kódují vlastnosti, které bakterie k životu nutně nepotřebuje –rezistenci vůči antibiotikům (tzv. RTF – Resistence Transfer Factor) –nové metabolické dráhy (např. odbourávání uhlovodíků apod.) –produkce toxinů

38 Plasmidy Význam v genetickém inženýrství –umělé plasmidy s požadovanými vlastnostmi

39 Replikace u bakterií Dvojsměrná 3 fáze 1.Iniciace (zahájení) –v tzv. místě ori (origin = počátek) 2.Elongace (prodlužování) 3.Terminace (zakončení)

40 Replikační enzymy u bakterií DNA polymerázy –3 druhy (DNA-pol I. II. a III.) dNTP + DNA n  PP + DNA n+1 –dNTP = dATP, dGTP, dCTP, dTTP –napojování nukleotidů na 3’-konec –neumí začátek řetězce, jen napojovat, potřebuje tzv. primer (očko) = krátká sekvence DNA nebo RNA DNA primáza –syntetizuje krátký fragment RNA - primer

41 N N N N N H 2 O HO H HH HH OPO O- O POPO O-O- OO

42 Replikační enzymy u bakterií DNA ligáza –spojuje delší řetězce DNA DNA helikázy –rozplétají dvojšroubovici na jednotlivá vlákna

43 Iniciace replikace 1. Rozpoznání ori místa –DnaA proteiny – najdou ori místo a oddělí v něm oba řetězce DNA –ori místo je bohaté na AT páry = snadno se oddělí –vznik tzv. replikační vidlice 2. Navázání helikáz –na oba konce vidlice se naváže helikáza a začne rozplétat DNA 3. Navázání DNA polymeráz a dalších replikačních enzymů

44 Iniciace replikace A A A A

45 A A A A

46 A A A A HH

47 A A A A HH

48 A A A A HH

49 A A A A HH Pol

50 Iniciace replikace A A A A HH Pol

51 Elongace DNA Syntézu obou řetězců katalyzuje enzymový komplex DNA-polymerázy III. Semidiskontinuální = jeden řetězec se syntetizuje nepřetržitě (vedoucí řetězec) a jeden po kratších úsecích (opožďující se řetězec) –Okazakiho fragmenty = krátké úseky DNA ( nukleotidů) –DNA polymeráza syntetizuje řetězec ve směru 5’-3’, ale řetězce mají opačnou orientaci cca 500 nukletidů / s

52 Pol Semidiskontinuální elongace 5’5’ 5’5’ 3’ vedoucí řetězec opožďující se řetězec 5’5’ 3’ Okazakiho fragmenty

53 Elongace DNA Syntéza opožďujícího se řetězce: 1.Syntéza RNA primeru (primáza) 2.Elongace fragmentu (DNA polymeráza I.) 3.Odstranění primeru (DNA polymeráza I.) 4.Zaplnění mezery (DNA polymeráza I.) 5.Spojení řetězců (DNA ligáza)

54 Pol Semidiskontinuální elongace 5’5’ 5’5’ 3’ vedoucí řetězec opožďující se řetězec 5’5’ 3’ primery

55 Terminace replikace Na tzv. ter místě Tus protein – inhibice helikázy

56 Replikace plasmidů Analogická repliklaci chromozómů Časově oddělená replikace vedoucího a opožďující se řetězce – tzv. replikace valivou kružnicí –nejprve je syntetizován vedoucí řetězec, který vytlačí původní – 1. kopie plasmidu –k vytlačenému původnímu řetězci se pomocí Okazakiho fragmentů dosyntetizuje nový řetězec – 2. kopie plasmidu

57 Replikace plasmidů

58 Replikace u eukaryot V principu stejná jako u bakterií Odlišnosti –jiné DNA polymerázy (ale s podobnou funkcí) –replikace probíhá na mnoha místech naráz –eukaryotické chromozómy jsou lineární  na 5’ konci nových řetězců chybí úsek, který není na co navázat – speciální enzym telomeráza 5’5’3’ 5’5’ 5’5’ 5’5’

59 Replikace u archeí Velice podobná bakteriální replikaci DNA polymerázy strukturně podobné eukaryotickým, ale s podobnou funkcí jako u bakterií

60 Transkripce u bakterií 3 fáze 1.Iniciace (zahájení) 2.Elongace (prodlužování) 3.Terminace (zakončení) Enzym RNA-polymeráza –5 podjednotek –    ’  Transkripce je zahajována na tzv. promotoru – uvozující úsek DNA –různé promotory u různých genů Rychlost cca 40 nukleotidů / s

61 Sigma faktor Podjednotka  (sigma faktor) má za úkol rozpoznat promotor –bakterie mají více sigma faktorů pro geny různého typu Síla promotoru = pravděpodobnost zahájení transkripce –geny se silnějším promotorem jsou více exprimovány –závisí na sekvenci promotoru i sigma faktoru

62 Pozitivní a negativní řetězec Transkripcí dsDNA vzniká ssRNA Přepisuje se jen jedno vlákno ze dvou = negativní vlákno Nepřepisované vlákno = pozitivní vlákno Analogie s fotografií – negativ a pozitiv

63 Iniciace transkripce 1. Spojení sigma-faktoru s RNA polymerázou promotorpřepisované geny     ’

64 Iniciace transkripce 2. Sigma podjednotka rozpozná promotor a naváže RNA polymerázu na DNA promotorpřepisované geny     ’

65 Iniciace transkripce 3. Rozpletení DNA

66 Iniciace transkripce 4. Zahájení syntézy RNA

67 Elongace RNA 5. Syntéza RNA – sigma-faktor se oddělí

68 1.Pomocí vlásenky terminátor = koncový úsek přepisované RNA palindromatická sekvence (symetrická) = páruje se sama se sebou a vzniká vlásenka vlásenka „vykolejí“ RNA polymerázu 2.Pomocí  -faktoru bílkovina, rozpoznávající terminátor interakce s RNA polymerázou a ukončení transkripce Terminace transkripce

69 Transkripce u eukaryot V principu stejná jako u bakterií Odlišnosti –více RNA polymeráz odlišných od bakteriální –odlišné promotory –k zahájení transkripce jsou potřeba iniciační faktory (bílkoviny); obvykle několik –složitější iniciace –složitější terminace, nejčastěji pomocí tzv. polyadenylačního signálu = sekvence AATAAA Posttranskripční úpravy mRNA

70 U eukaryot je přepsaná mRNA ještě podrobena tzv. posttranskripčním úpravám –vytvoření tzv. čepičky na 5’-konci –komplex se specifickými proteiny –sestřih = odstranění intronů –polyadenylace 3’-konce

71 Transkripce u archeí Podobnosti i odlišnosti proti bakteriím a eukaryím Podobnosti s eukaryotickou transkripcí –podobné RNA-polymerázy –podobné iniciační faktory Podobnosti s bakteriální transkripcí –žádné posttranskripční úpravy mRNA –podobné promotory –přepis operonů do jedné mRNA

72 Bakteriální translace

73 tRNA Prostředník při překladu z genetického kódu do „řeči“ aminokyselin Jednu aminokyselinu může přenášet více tRNA = izoakceptorové Ve struktuře tRNA jsou zařazeny i nestandardní nukleotidy (pseudouridin, 1- methylguanozin…) – vznik modifikací standardních nukleotidů nukleotidů sekundární struktura připomíná jetelový lístek

74 tRNA Vazebné místo pro aminokyselinu Antikodon Smyčky

75 Antikodon Sekvence 3 nukleotidů komplementární s kodonem pro danou aminokyselinu Nestandardní nukleotidy umožňují rozšířené párování

76 Aktivace aminokyselin Proces napojování aminokyselin na tRNA Pro každý pár aminokyselina-tRNA existuje jeden enzym aminoacyl-tRNA-syntetáza –Rozpoznává správné aminokyseliny i tRNA –Syntetizuje jejich vazbu (energie ze štěpení ATP) aa + ATP  aa-AMP + PP aa-AMP + tRNA  aa-tRNA + AMP

77 Bakteriální ribozómy Kuličky složné z bílkovin a rRNA Označení komponent podle sedimentačního koeficientu –celý bakteriální ribozóm má sedimentační koeficient 70S –16S-rRNA, 23S-rRNA, 5S-rRNA Dvě podjednotky –malá 30S –velká 50S

78 Vazebná místa na ribozómu Vazebné místo pro mRNA Aminoacylové místo (A-místo) – vazba nepřipojené aa-tRNA Peptidylové místo (P-místo) – vazba už hotového peptidového řetězce Výstupní místo pro tRNA (E-místo) – odchod deacylované tRNA

79 Průběh translace 1.Iniciace rozpoznání čtecího rámce zařazení první aminokyseliny (formylmethionin) iniciační faktory (IF) - bílkoviny 2.Elongace – prodlužování řetězce elongační faktory (EF) 3.Terminace terminační (nesmyslný) kodon = nekóduje žádnou aminokyselinu, ale konec řetězce účast terminačních faktorů (RF)

80 Iniciace translace 1.Rozpad ribozómu na podjednotky EPA

81 Iniciace translace 2.Navázání fMet-tRNA EPA fMet

82 Iniciace translace 3.Navázání mRNA –správné umístění pomocí tzv. Shine-Dalgarnovy sekvence EPA fMet

83 Shine-Dalgarnova sekvence Sekvence AGGA na mRNA, která se páruje s UCCU na 16S-rRNA Zajišťuje správné umístění mRNA na ribozóm AGGA 3’ 5’5’ mRNA 16S-rRNA UCCU AUG 5’ iniciační kodon ribozóm

84 Iniciace translace 4.Znovuspojení ribozomálních podjednotek EPA fMet

85 Elongace polypeptidového řetězce 6. Navázání další aminokyseliny do A místa EPA fMet Trp

86 Elongace polypeptidového řetězce 7. Vznik peptidové vazby EPA Trp fMet

87 EA Elongace polypeptidového řetězce 8. Posun ribozómu Trp P

88 EA fMet Elongace polypeptidového řetězce 9. Navázání další aminokyseliny Trp P Lys

89 EA Elongace polypeptidového řetězce 10. Vznik peptidové vaby P Lys fMet Trp

90 EAP Elongace polypeptidového řetězce 11. Posun ribozómu Lys fMet Trp

91 Elongace peptidového řetězce mRNA

92 Terminace translace Terminační faktory RF1 a RF2 rozpoznají terminační kodón a za spolupráce s RF3 způsobí uvolnění tRNA, peptidu a rozpad ribozómu na podjednotky

93 Rychlost proteosyntézy aminokyselin / s chybovost cca 1 nesprávná aminokyselina na 2000 správných

94 Translace polygenních RNA U bakteriích je mnoho mRNA polygenních = nesou více genů (např. operony) U každého genu nová iniciace translace

95 Návaznost transkripce a translace U bakterií dochází k rychlému navazování transkripce a translace –na nehotovou mRNA už nasedají ribozómy a překládají polypeptid –na jedné RNA může být současně ribozómů posunujících se „za sebou“

96 RNA pol DNA RNA

97 RNA pol DNA ribozóm RNA peptid

98 Eukaryotická transalce V principu podobná bakteriální ale s odlišnostmi –ribozómy jsou větší a odlišné (80S) volné vázané na endoplasmatické retikulum – syntéza membránových bílkovin –první aminokyselinou je methionin a ne formylmethionin –eukarya nepoužívají Shine-Dalgarnovu sekvenci, správný začátek transalce je rozpoznáván pomocí čepičky –více translačních faktorů

99 Eukaryotická transalce Prostorové oddělení eukaryální transkripce a translace –transkripce probíhá v jádře –translace probíhá mimo jádro – nutný transport Časové oddělení –translace probíhá teprve po dokončení všech posttranskripčních úprav

100 Archeální transalce Podobnosti s bakteriální transalcí –podobné ribozómy –používání Shine-Dalgarnovy sekvence Podobnosti s eukaryální translací –podobné translační faktory

101 Mutace Změna dědičné (genetické) informace Obvykle předávaná dalším generacím

102 Mutace Dělení podle příčiny –samovolné (spontánní) – chyby při replikaci DNA –vyvolané (indukované) – způsobené faktory vnějšího prostředí (mutageny)

103 Mutace Dělení podle rozsahu –bodové – změna jednoho páru bazí –chromozómové – změna delšího úseku DNA –genomové – změna počtu chromozómů (jen u eukaryot)

104 Mutace Dělení podle následků –neutrální – žádný vliv na vlastnosti a životaschopnost –téměř neutrální – přibližně nulový vliv na vlastnosti a životaschopnost –negativní – zhoršení vlastností či životaschopnosti –pozitivní – zlepšení vlastností či životaschopnosti

105 Mutace Dělení podle následků –neutrální – žádný vliv na vlastnosti a životaschopnost –téměř neutrální – přibližně nulový vliv na vlastnosti a životaschopnost –negativní – zhoršení vlastností či životaschopnosti –pozitivní – zlepšení vlastností či životaschopnosti pokles pravděpodobnosti

106 Bodové mutace Obvykle změna jedné báze, ke které se při další replikaci připáruje správná ATTCTTGCGGTCGAATGCCGCTCAATCGG TAAGAACGCCAGCCTACGGCGAGTTAGCC

107 Bodové mutace Obvykle změna jedné báze, ke které se při další replikaci připáruje správná ATTCTTGCGGTCGAATGCCGCTCAATCGG TAAGAACGCCAGCCTACGGCGAGTTAGCC

108 Bodové mutace Obvykle změna jedné báze, ke které se při další replikaci připáruje správná ATTCTTGCGGTCGAATGCCGCTCAATCGG TAAGAACGCCAGCTTACGGCGAGTTAGCC ATTCTTGCGGTCGGATGCCGCTCAATCGG TAAGAACGCCAGCCTACGGCGAGTTAGCC

109 Bodové mutace Typy bodových mutací –tranzice – výměna purinu za purin resp. pyrimidinu za pyrimidin (A↔G C↔T) –transverze – výmna purinu za pyrimidin a opačně (A,G↔C,T) –inzerce – vložení nového páru bazí –delece – odstranění jednoho páru bazí Inzerce a delece mění čtecí rámec

110 Bodové mutace Mutace s chybným smyslem (missense) = mutací vznikne kodon pro jinou aminokyselinu –kódovaná bílkovina si obvykle uchová aktivitu Nesmyslné mutace (nonsense) = mutací vznikne stop-kodon –vzniká neúplná bílkovina obvykle bez funkce

111 Chromozómové mutace Vznikají zlomem DNA a chybným znovuspojením koncová deficience – chybí koncová část DNA interkalární delece – chybí vnitřní část DNA inverze – část DNA je vložena obráceně translokace – přeskupení DNA duplikace – zdvojení DNA

112 Chromozómové mutace Původní DNAA B C D E F G Koncová deficienceA B C D E Interkalární deleceA B C F G InverzeA D C B E F G TranslokaceA B D E F G C DuplikaceA B C D C D C D E F G

113 Genomové mutace Změna počtu chromozómů Zvýšení a snížení Polyploidie = znásobení genetické informace –obvykle max. hexaploidie, víceplodiní jádra se při mitóze rozpadají na dvě Aneuploidie = neúplná genetická informace

114 Spontání mutace Způsobené bez viditelného vlivu mutagenu Nesprávné párování bazí Deaminace bazí –C  U (páruje se s A) –A  hypoxantin (páruje se s C) –G  xantin (nepáruje se, zastavení translace) Oxidativní poškození –kyslíkové radikály, hlavně OH·, vznik z H 2 O 2 (vedlejší produkt dýchacího řetězce) –různé produkty se změněným párováním nebo bez párování

115 Mutageny mutagen = fyzikální faktor nebo chemická látka způsobující mutace Analoga bazí – strukturní podobnost, bazím, ale odlišné párování –bodové mutace –př. 5-bromuracil (AT↔GC) Kyselina dusitá – deaminace Alkylační látky – křížové vazby mezi řetězci Interkalární látky – planární molekuly, vmezeřují se mezi báze DNA a narušují operace s DNA –polyaromatické uhlovodíky

116 Mutageny Ionizující záření (rentgen, radioaktivní…) –excitace elektronů a vznik náhodných vazeb –vliv přímo na DNA nebo nepřímo přes jiné molekuly, zejména vodu –zlomy v DNA –změny bazí UV záření – NK absorbují mezi nm –vznik thyminových dimerů

117 Reparační procesy Buňky mají schopnost opravy (reparace) poškozené DNA –menší poškození je možno odstranit bez ztráty genetické informace Úplná oprava – chemická reakce odstraňující poškození –odstranění thyminových dimerů Excizní oprava – vyštěpení jednoho řetězce v chybném místě a jeho správné dotvoření Tolerantní oprava – úprava poškozené DNA neodstraňující mutaci, ale umožňující funkci DNA (replikace, transkripce)

118 Konjugace u bakterií Proces výměny genetického materiálu mezi některými rody G- bakterií Je možný i mezi různými rody Zdroj variability a odolnosti bakterií Výměna probíhá pomocí kanálků tvořených fimbriemi Geny pro fimbrie jsou kódovány na F plazmidu (F + / F - ) F plazmid je epizóm = může se integrovat do genomu a vyštěpovat zpět jako plazmid

119 F +  F - konjugace Proces je jednosměrný z F + buňky do F - buňky –F + - mají F plazmid, jsou schopné tvorby fimbrií a přenosu genetické informace –F - - nemají F plazmid, mohou být akceptory Konjugace neprobíhá ve směru F +  F + F - buňka se po přijetí stává F + buňkou F + buňka zůstává F + buňkou

120 F +  F - konjugace 1. Spojení buněk kanálkem F+F+ F-F-

121 F +  F - konjugace 1. Spojení buněk kanálkem F+F+ F-F-

122 F +  F - konjugace 1. Spojení buněk kanálkem F+F+ F-F-

123 F +  F - konjugace 2. replikace F-plazmidu valivou kružnicí F+F+ F-F-

124 F +  F - konjugace 3. Dokončení druhého vlákna plazmidu F+F+ F-F-

125 F +  F - konjugace 4. Oddělení buněk F+F+ F-F-

126 Hfr konjugace Hfr = High frequency of recombination (vysoká frekvence rekombinace) Nastává, pokud se F-plazmid integruje do chromozómu S F-plazmidem se přenáší i kus chromozómu –přenos mnoha genů –začátek v místě integrace F-plazmidu Velmi pomalý proces (u E.coli cca 100 minut) – často předčasné přerušení Obvykle se nepřenese celý F-plazmid – recipientní buňka zůstane F -

127 Hfr konjugace 1. Spojení buněk kanálkem HfrF-F-

128 Hfr konjugace 1. Spojení buněk kanálkem HfrF-F-

129 Hfr konjugace 1. Spojení buněk kanálkem HfrF-F-

130 Hfr konjugace 2. přenos části DNA do druhé buňky HfrF-F-

131 Hfr konjugace 3. rozpad spojení HfrF-F-

132 Hfr konjugace 4. Integrace části přenesené DNA do chromozómu příjemce HfrF-F-

133 Další konjugace Existuje ještě řada dalších procesů výměny genetické informace mezi bakteriemi s různým mechanismem


Stáhnout ppt "Genetika mikroorganismů Z latinského genaó = tvořím Přenos genetické informace je základní atribut živé hmoty Základní genetické pochody jsou konzervativní."

Podobné prezentace


Reklamy Google