Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Kurz pro kombinovaná studia Prof. Ing. Václav Řehout, CSc., 2013 CytogenetikaCytogenetika Molekulární genetikaMolekulární genetika Úvod do obecné genetikyÚvod.

Podobné prezentace

Prezentace na téma: "Kurz pro kombinovaná studia Prof. Ing. Václav Řehout, CSc., 2013 CytogenetikaCytogenetika Molekulární genetikaMolekulární genetika Úvod do obecné genetikyÚvod."— Transkript prezentace:

1 Kurz pro kombinovaná studia Prof. Ing. Václav Řehout, CSc., 2013 CytogenetikaCytogenetika Molekulární genetikaMolekulární genetika Úvod do obecné genetikyÚvod do obecné genetiky Genetické patologické stavyGenetické patologické stavy Prevence genetických patologických stavůPrevence genetických patologických stavů

2 Cytogenetika prof. Ing. Václav Řehout, CSc.

3 Člověk má cca 2m DNA Cytologie cytogenetika karyologie Organely nesoucí DNA (RNA) Na ní 20 000 genů (lokusů) V interfázi despiralizovaná DNA 2m = 2000km vlasce rozprostřeného v místnosti 4x4m Rozdělených na 46 chromozomů

4 Morfologie chromozomů

5 Submikro- skopická struktura chromozomu

6 Tvary chromozomů

7 Mitoza – metafáze

8 Zpracování karyotypu - klasické metody (monochromatické barvení) - moderní metody ( např. proužkovací techniky)

9 Karyotyp člověka

10 Comparative genomic hybridization (CGH)

11 Karyotyp trisomie 21


13 Úvod molekulární genetika - studium procesů podmiňujících dědičnost a proměnlivost na molekulární úrovnimolekulární genetika - studium procesů podmiňujících dědičnost a proměnlivost na molekulární úrovni genetická informace (GI) je zakódována v DNA - uložena v J buňky v chromozómechgenetická informace (GI) je zakódována v DNA - uložena v J buňky v chromozómech Odhalení funkce NK – Avery (1944) – „Averyho bomba“Odhalení funkce NK – Avery (1944) – „Averyho bomba“ odhalení genetického kódu (GK) - Watson a Crick (1953) - zlomový objev pro další rozvoj molekulární genetikyodhalení genetického kódu (GK) - Watson a Crick (1953) - zlomový objev pro další rozvoj molekulární genetiky v posledních desetiletích bouřlivý rozvoj MG - projekty:v posledních desetiletích bouřlivý rozvoj MG - projekty:

14 Nukleové kyseliny DNA = deoxyribonukleová k. (deoxyribonucleic acid) (deoxyribonucleic acid) dvouvláknová - dvoušroubovice Funkce: DNA - nositel GI *) *) u některých virů je nositelem GI: RNA - např. medicínsky důležité viry: - např. medicínsky důležité viry: - virus chřipky - virus chřipky - virus HIV (Humane Immunodeficiency Virus) - vyvolává AIDS - virus HIV (Humane Immunodeficiency Virus) - vyvolává AIDS RNA = ribonukleová kyselina (ribonucleic acid) (ribonucleic acid)jednovláknová RNA - podíl na realizaci GI chromozómy se skládají z řady makromolekul: - cca 60–90 % tvoří zhruba ve stejném poměru DNA a histony (bázické proteiny), - cca 60–90 % tvoří zhruba ve stejném poměru DNA a histony (bázické proteiny), - dále nehistonové proteiny a molekuly RNA - dále nehistonové proteiny a molekuly RNA

15 DNA

16 Struktura NK - pětiuhlíkatá ribóza (v RNA) - deoxyribóza (v DNA) - deoxyribóza (v DNA) na 3. a 5. atomu uhlíku na 3. a 5. atomu uhlíku fosfátová skupina fosfátová skupina spojuje molekuly cukru navzájem do řetězce spojuje molekuly cukru navzájem do řetězce na 1. atomu uhlíku cukru na 1. atomu uhlíku cukru - purinové A, G - purinové A, G - pyrimidinové báze T, - pyrimidinové báze T, - DNA: A, T, G, C - DNA: A, T, G, C - RNA: A, U, G, C - RNA: A, U, G, C nukleotid X nukleosid pětiuhlíkatý cukr + fosfátová skupina + dusíkatá báze báze + deoxyribóza Základní stavební kamen NK: nukleotid = cukr + fosforečný zbytek + dusíkatá báze

17 Komplementarita bází A - T DNA A - U RNA A - T DNA A - U RNA C - G C - G C - G C - G Příklad komplementarity: 1. vlákno 1. vlákno 2. vlákno 2. vlákno AGTCAGTCTCAGTCAGAGTCAGTCTCAGTCAGAGTCAGTCTCAGTCAGAGTCAGTCTCAGTCAG

18 Genetický kód - soubor pravidel, podle kterých se genetická informace uložená v DNA, resp. RNA, převádí na primární strukturu bílkovin - tj. pořadí v DNA, resp. RNA, převádí na primární strukturu bílkovin - tj. pořadí aminokyselin v řetězci aminokyselin v řetězci Vlastnosti - GK je: 1. tripletový - pořadí tří nukleotidů určuje aminokyselinu - trojice bází kóduje 1 AA (trojice nukleotidů = kodon, triplet) kóduje 1 AA (trojice nukleotidů = kodon, triplet) 2. univerzální - u všech organismů kóduje 1 a ten samý triplet stejnou AA (pravidlo platí pro velkou většinu kodonů, AA (pravidlo platí pro velkou většinu kodonů, u některých organismů mají některé kodony odlišný u některých organismů mají některé kodony odlišný smysl) smysl) 3. degenerovaný (nadbytečný) - 1 AA může být determinována více kodony (1 AA je kódována více kodony (1 AA je kódována více triplety) triplety) 4. bez mezer a nepřekrývající se - jednotlivé kodony v molekule NK následují bezprostředně za sebou


20 Gen = úsek DNA, která má: 1. specifickou funkci v buňce a v celém organismu - musí být schopen utvářet dědičný znak nebo spolupracovat při utváření několika takovýchto dědičných znaků 2. je schopen vytvářet přesné vlastní kopie - přenášet svou funkci z generace na generaci 3. charakteristickou vlastností genu je schopnost náhle změnit svou strukturu a tím i funkci, tj. podléhat mutacím. Zmutovaný gen replikuje svou změněnou podobu. Lokus - místo na chromozomu, na kterém je gen umístěn Alely - odlišné formy téhož genu, které u různých jedinců téhož druhu alterují na jednom lokusu (uspořádání lokusů je pro druh konstantní)

21 AT CG GC AT TA CG ≡ ≡ ≡ = = = 1. Triplet 2. Triplet = 3 nukleotidy Celá molekula DNA 3,2 miliardy nukleotidů 1,5 metru SYNTÉZA MOLEKULY DNA

22 MOLEKULA DNA REPLIKACE DNA je věčná nově nevzniká pouze se zdvojuje a předává se z rodičů na děti absorbuje změny (mutace) člověk  výsledek nahromadění mutací od mikroorganizmů do dneška


24 POČTY GENŮ V GENOMECH Viry5 – 10 Mycoplazma genitalium470 Rickettsia p.834 Helicobacter pylori1 743 Escherichia c.4 300 Sac c aromyces c.6 000 Drosophila m.12 000 Obratlovci - Homo sapiens20 000 - 25 000

25 2008

26 Johann Gregor Mendel 1822-1884  narozen 22. června 1822 v Hynčicích ve Slezsku  1843 vstup do augustiniánského kláštera na Starém Brně  1851 – 1853 studia ve Vídni  1856 počátek experimentů s hrachem, celkem okolo 28 000 rostlin  1865 Versuche über Pflanzen-Hybride  1868 zvolen opatem  6. ledna 1884 umírá  1900 Mendelova práce znovuobjevena: Hugo de Vries (Nizozemí), Erich von Tschermak (Rakousko), Carl Correns (Německo)

27 Důležité termíny  každá „dědičná vlastnost“ je u diploidního organismu řízena dvěma geny; jeden jsme zdědili od otce, druhý od matky  výjimkou jsou u muže geny na chromozómu X a na chromozómu Y. (Pozn. genů na chromozómu Y je velmi málo)

28 Důležité termíny  Alely = různé varianty téhož genu. Pro jeden gen máme v našem těle dvě alely; jednu jsme zdědili od otce, druhou od matky. Hovoříme např. o genu pro barvu květů, a o alele způsobující fialovou barvu a o alele způsobující bílou barvu květu.  To ale neznamená, že v populaci jsou vždy jen dvě alely. Známe např. tři alely pro dědičnost krevních skupin, I A, I B, i. V konkrétním člověku jsou vždy pouze dvě z nich. V populaci kolují všechny tři.

29 Alely lokus = konkrétní místo na chromozómu, na kterém se nachází určitý gen

30 Homologní chromosomy Žluté tečky označují jistý gen – a jeho lokus – na homologních chromosomech. Tyto chromosomy jsou již zreplikované po S fázi – což je poznat z toho, že na každém z obou homologních chromosomů jsou žluté tečky dvě.

31 Důležité termíny  genom = kompletní genetický materiál daného organismu  genotyp = soubor alel, které má organismus k dispozici  fenotyp = fyzické a fyziologické rysy daného organismu (=to, jak organismus aktuálně vypadá)  čistá linie = rostliny, které při samoopylení vykazují opakovaně stejnou variantu sledovaného znaku (jsou homozygotní)

32 Užitečné termíny  homozygot = organismus, který má pro daný znak obě alely identické (např. PP nebo pp). Pokud má organismus obě alely dominantní pro sledovaný znak, užíváme termín dominantní homozygot (PP), pokud jsou obě alely recesívní, užíváme termín recesívní homozygot  heterozygot = organismus, který má obě alely pro sledovaný znak odlišné (Pp)

33 vztah mezi alelami dominance – dominantní alela převládá nad ostatními a projeví se vždy ve fenotypu recesivita –recesivní alela je překryta účinkem dominantní formy, ve fenotypu se projeví pouze v homozygotním stavu neúplná dominance – obě alely se ve fenotypu projeví současně kodominance – alely se projeví ve fenotypu nezávisle na sobě (krevní skupiny) superdominance – heterozygotní konstituce je aktivnější než obě homozygotní

34 Všechny chorobné stavy způsobené změnou (mutací) genetické informace Genetické patologické stavy

35 DLE HMOTNÉ PODSTATY Monogenní Chromozomové aberace Multifaktoriální (polygenní) Třídění DLE BUNĚČNÉ ÚROVNĚ genetické poruchy somatických buněk mitochondriální genetické choroby Genetické patologické stavy

36 1/50 novorozenců má vrozenou poruchu (genetické i negenetické etiologie) 1/100 má monogenní chorobu 1/200 nese chromozomální aberaci Frekvence výskytu Genetické patologické stavy

37 vznikají mutací genů jednoduchá mendelistická dědičnost s typem dědičnosti: - recesivním - dominantním - pohlavně vázanou asi 1% populace nese tento typ choroby celkem asi 30 000 lokusů strukturálních genů dosud popsáno asi 10 000 lokusů s výskytem patologických alel tj. asi každý třetí gen je patologický ( v roce 1980 jich bylo známo asi 2000) teoretický předpoklad je mnohem vyšší Monogenní choroby Genetické patologické stavy

38 Monogenní choroby - příklad morfologické abnormality Genetické patologické stavy

39 Schema metabolické poruchy Genetické patologické stavy Normální gen Genový produkt Normální koncentrace gen. produktu Normální fenotyp Defektní gen Defektní genový produkt Změněná koncentrace gen. produktu Genetická choroba

40 Příklad - Fenilketonurie Substrát - fenylalanin Genetické patologické stavy Defekt genu pro produkci fenylalaninhydroxylázy Neaktivní fenylalaninhydroxyláza Hromadění fenylalaninu v krvi (poškození nerv. systému, oligofrenie, ekzémy, charakteristický zápach moče po myších atd.)

41 Početní anomálie: -např. trisomie ch. č. 21Dawnův syndrom Klinefelterův syndrom XXY muž Turnerův syndrom X 0 žena Choroby podmíněné anomálií chromozomů Genetické patologické stavy Změněný fenotyp nositele anomálie

42 Podmíněné větším počtem genů -často za spoluúčasti prostředí G + E = P Např. krevní tlak, inteligence, psychické poruchy apod. -bez spoluúčasti prostředí Např. polydaktylie, vrozené vady srdce, arteroskleroza, aj. Multifaktoriální (polygenní) choroby Genetické patologické stavy

43 Počet na 1000 narozených dětí (otec v podstatě neovlivňuje) Závislost VCA na věku matky Abnormální karyotypy u 20 letých matek 1 u 30 letých matek 1,5 u 36 letých matek 7 u 40 letých matek 15 u 45 letých matek50

44 Fenotypový projev chrom. aberací = špička ledovce

45 PREVENCE genetických patologických stavů (GPS)

46 Primární Plánované rodičovství – doba početí, počet dětí, intervaly mezi početím Reprodukce v optimálním věku – podle SZO (WHO) má dojít ke splnění rodičovských povinností do 25. roku věku Prevence GPS Prevence mutací – omezení vlivu mutagenních faktorů Předkoncepční opatření – ochrana ženy před koncepcí, nikoliv až po zjištění gravidity Genetické konzultace – genetické poradenství – při podezření na gen. chorobu

47 Sekundární Zábrana narození postihnutého plodu – genetické konzultace – prenatální diagnostika Postnatální novorozenecký screening Zábrana klinické manifestace patologického genu – vyřazení metabolitu z potravy, náhradní podávání chybějícího enzymu apod. (problematické) Prevence GPS

48 Genetická diagnostika GPS Předimplantační Postimplantační Postnatální

49 Předimplantační genetická diagnostika oplozené vajíčko odběr jedné blastoméry blastoméra embryo 3 dny kultivace izolace DNA PRC, RFLP, aj. genetická diagnostika

50 Postimplantační genetická diagnostika Technika amniocentézy

51 Postnatální genetická diagnostika Po předchozích stupních diagnostiky (potvrzení nebo vyloučení GPS) Při podezření porodníka nebo pediatra na GPS Při pozitivním výsledku novorozeneckého screeningu Kdykoliv v průběhu ontogeneze (života) Při podezření na: - GPS probanda - GPS potomků

52 Informovaný souhlas

53 Novorozenecký screening je aktivní celoplošné vyhledávání chorob v jejich časném, preklinickém stadiu tak, aby se tyto choroby diagnostikovaly a léčily dříve, než se stačí projevit a způsobit novorozenci nevratné poškození zdraví. V současné době je prováděn screening na 13 poruch. Novorozenecký screening

54 Počet nemocí screenovaných u novorozenců v jednotlivých evropských zemích 10/2009

Stáhnout ppt "Kurz pro kombinovaná studia Prof. Ing. Václav Řehout, CSc., 2013 CytogenetikaCytogenetika Molekulární genetikaMolekulární genetika Úvod do obecné genetikyÚvod."

Podobné prezentace

Reklamy Google