Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

SLIDE-POOL FORENZNÍ GENETIKY rozšířený soubor obrazových schémat k publikaci Breviář forenzní genetiky výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080.

Podobné prezentace

Prezentace na téma: "SLIDE-POOL FORENZNÍ GENETIKY rozšířený soubor obrazových schémat k publikaci Breviář forenzní genetiky výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080."— Transkript prezentace:

1 SLIDE-POOL FORENZNÍ GENETIKY rozšířený soubor obrazových schémat k publikaci Breviář forenzní genetiky výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“ Autorka: Mgr. Halina Šimková Recenzoval: doc. Jiří Drábek, Ph.D. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Všechna práva vyhrazena.

2 O PROJEKTU Projekt: 4N6gen - vzdělávání v oblasti forenzní genetiky, Registrační číslo: CZ.1.07/2.3.00/09.0080 Název programu: Operační program vzdělání pro konkurenceschopnost Prioritní osa: 2 – Terciární vzdělávání Oblast podpory:2.3 – Lidské zdroje ve výzkumu a vývoji Název příjemce:Československá společnost pro forenzní genetiku, IČ 27033724, Řešitel: Doc. Mgr. Jiří Drábek, PhD. Realizace projektu: 1. 7. 2009 – 31. 6. 2012 Projekt 4N6gen si klade za cíl podpořit a rozvíjet týmovou spolupráci a další vzdělávání pracovníků vědy a výzkumu ve forenzní genetice. Realizační tým ČSSFG tímto projektem vzdělává české odborníky v nejnovějších poznatcích v oboru a v současných bioinformatických nástrojích pro interpretaci výsledků DNA profilování. Zároveň chce nastavit formální a neformální spolupráci mezi kriminalistickými a univerzitními institucemi. Horizontálním výstupem projektu je zlepšení soudní interpretace výsledků forenzně genetické práce. Celý projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

3 SLIDE-POOL: PODMÍNKY UŽITÍ SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. materiál je určen: • k samostudiu pro neomezenou cílovou skupinu • k veřejné prezentaci v rámci nekomerčních odborných forenzně genetických přednášek prezentovány mohou být jednotlivé snímky nebo materiál jako celek pro veřejnou prezentaci nesmějí být jednotlivé snímky jakkoli upravovány, pozměňovány či doplňovány; rovněž nesmějí být odstraňovány ochranné a identifikační prvky materiálu jednotlivé snímky mohou být v nezměněné podobě začleněny do vlastní prezentace za podmínky zachování všech ochranných a identifikačních prvků není dovoleno vyjímat dílčí části snímků (např. jednotlivá schémata) a vkládat je do vlastních prezentací či jiných materiálů veřejně prezentovaných nebo šířených tiskem či elektronicky všechny části slide-poolu jsou původní a podléhají autorským právům materiál jako celek může být volně šířen v elektronické či tiskové podobě za podmínky nezasahování do něj materiál není zbožím a nesmí být v žádné formě obchodován

4 SLIDE-POOL: CHARAKTERISTIKA SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. tento slide-pool je doplňkovým materiálem publikace „Breviář forenzní genetiky“ autorky Haliny Šimkové, vydané v r. 2012 Československou společností pro forenzní genetiku v rámci realizace grantového projektu 4N6gen - vzdělávání v oblasti forenzní genetiky materiál přináší základní obrazová schémata k jednotlivým kapitolám knihy; obsažena jsou jednak schémata použitá v knize ve formě ilustrací, jednak další - doplňující a rozšiřující materiál je zpracován ve formátu.pptx,.ppt a.pdf

5 SLIDE-POOL: STRUKTURA SNÍMKŮ Název snímku Číslo sekce a číslo tabule (snímku) Ochranné a identifikační prvky Schéma SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

6 O AUTORCE SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. Mgr. Halina Šimková vystudovala odbornou biologii se specializací na genetiku člověka a antropologii na Přírodovědecké fakultě Univerzity Karlovy v Praze. Už v době studia působila dva roky jako civilní stážistka na Kriminalistickém ústavu Praha Policie ČR, od roku 2002 zde pracuje jako DNA expertka na oddělení genetických expertíz. V roce 2005 se jako DNA specialistka účastnila mise Interpolu při identifikacích obětí tsunami v Thajsku. Po ukončení studií v r. 2002 spoluzaložila a přednáší předmět Forenzní genetika na PřF UK. Velkou prioritou pro ni vždy byla a je didaktika oboru – kromě odborných přednášek na univerzitě se věnuje přípravě budoucích expertů, specializačnímu dalšímu vzdělávání stávajících znalců a expertů, odbornému vzdělávání kriminalistů, přednáší pro soudce a státní zástupce, ale nesmírně ráda také přibližuje obor naprostým laikům při přednáškách pro veřejnost. Je zakládající členkou Československé společnosti pro forenzní genetiku, od roku 2007 je její místopředsedkyní. Kromě biologie se ráda věnuje výtvarným aktivitám (v r. 1995 absolvovala studium scénografie a kostýmního výtvarnictví na Soukromé mistrovské škole uměleckého designu v Praze, v letech 1998-1999 byla studentkou animované tvorby na FAMU); své dovednosti v této oblasti nyní uplatňuje při tvorbě výukových materiálů, jako je tento SLIDE-POOL.

7 SLIDE-POOL: OBSAH (1) Sekce I.: Forenzní genetika jako obor • Tabule 1: Základní aplikace forenzní genetiky a související obory • Tabule 2: Historie, současnost a budoucnost forenzní genetiky Sekce II.: Biologické stopy a biologický materiál • Tabule 3: Co je biologický materiál a biologická stopa • Tabule 4: Charakteristiky biologické stopy • Tabule 5: Orientační a specifické zkoušky tkáňového původu biologického materiálu • Tabule 6: Standardní srovnávací vzorky osob • Tabule 7: Speciální srovnávací vzorky osob • Tabule 8: Vyhledávání biologických stop • Tabule 9: Příčiny degradace DNA • Tabule 10: Odběr biologického materiálu • Tabule 11: Kontaminace stopy • Tabule 12: Biologická stopa v čase • Tabule 13: Primární a sekundární přenos biologického materiálu • Tabule 14: Důkazní potenciál stopy SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

8 SLIDE-POOL: OBSAH (2) Sekce III.: Seznámení s genetikou • Tabule 15: Struktura jednořetězcové DNA • Tabule 16: Struktura dvouřetězcové DNA • Tabule 17: Další stupně uspořádání DNA • Tabule 18: Karyotyp • Tabule 19: Genetický kód • Tabule 20: Replikace – transkripce – translace • Tabule 21: Gen – lokus – marker • Tabule 22: DNA v lidské buňce • Tabule 23: Příčiny variability • Tabule 24: Polymorfismus a variabilita lokusů v DNA • Tabule 25: Mitóza (mitotické dělení) • Tabule 26: Meióza (redukční dělení) • Tabule 27: Oplození • Tabule 28: Dědičnost autozomálních lokusů • Tabule 29: Dědičnost Y–chromozomálních lokusů • Tabule 30: Dědičnost X–chromozomálních lokusů • Tabule 31: Dědičnost mitochondriální DNA SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

9 SLIDE-POOL: OBSAH (3) Sekce IV.: Forenzní potenciál genetické analýzy • Tabule 32: Individualita a identifikace • Tabule 33: Geneta a rameta • Tabule 34: Modulární a unitární organismy • Tabule 35: Genetický profil osoby • Tabule 36: Genetická informace jednovaječných dvojčat • Tabule 37: Genetická informace dvojvaječných dvojčat • Tabule 38: Genetická informace chimérického jedince • Tabule 39: Směna buněk mezi dvojvaječnými dvojčaty • Tabule 40: Maternální a fetální mikrochimérismus • Tabule 41: Posttransplantační chimérismus • Tabule 42: Očekávaná shoda u dvojice matka – dcera • Tabule 43: Očekávaná shoda u dvojice matka – syn • Tabule 44: Očekávaná shoda u dvojice otec – dcera • Tabule 45: Očekávaná shoda u dvojice otec – syn • Tabule 46: Očekávaná shoda u dvojice sestra – sestra • Tabule 47: Očekávaná shoda u dvojice sestra – bratr • Tabule 48: Očekávaná shoda u dvojice bratr – bratr • Tabule 49: Očekávaná shoda u dvojice babička z matčiny strany – vnučka • Tabule 50: Očekávaná shoda u dvojice babička z matčiny strany – vnuk SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

10 SLIDE-POOL: OBSAH (4) • Tabule 51: Očekávaná shoda u dvojice dědeček z matčiny strany – vnučka • Tabule 52: Očekávaná shoda u dvojice dědeček z matčiny strany – vnuk • Tabule 53: Očekávaná shoda u dvojice babička z otcovy strany – vnučka • Tabule 54: Očekávaná shoda u dvojice babička z otcovy strany – vnuk • Tabule 55: Očekávaná shoda u dvojice dědeček z otcovy strany – vnučka • Tabule 56: Očekávaná shoda u dvojice dědeček z otcovy strany – vnuk • Tabule 57: Očekávaná shoda u dvojice nevlastních sester (společná matka) • Tabule 58: Očekávaná shoda u dvojice nevlastních sester (společný otec) • Tabule 59: Očekávaná shoda u dvojice nevlastní sestra a bratr (společná matka) • Tabule 60: Očekávaná shoda u dvojice nevlastní sestra a bratr (společný otec) • Tabule 61: Očekávaná shoda u dvojice nevlastních bratrů (společná matka) • Tabule 62: Očekávaná shoda u dvojice nevlastních bratrů (společný otec) • Tabule 63: Rodokmen – stupeň příbuznosti • Tabule 64: Rodokmen – dědičnost autozomálních lokusů • Tabule 65: Rodokmen – dědičnost X–chromozomálních lokusů • Tabule 66: Rodokmen – dědičnost Y–chromozomálních lokusů • Tabule 67: Rodokmen – dědičnost mitochondriální DNA • Tabule 68: Rodokmen – konsangvinita a incest • Tabule 69: Rodokmen – mnohotný incest • Tabule 70: Rodokmen – Ancestry Informative Markers • Tabule 71: Predikce fenotypových znaků SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

11 SLIDE-POOL: OBSAH (5) Sekce V.: Obecné principy forenzně genetické analýzy • Tabule 72: Struktura krátké tandemové repetice (STR) • Tabule 73: Alely STR lokusu – standardní a mikrovariantní • Tabule 74: Srovnání genotypu stopy a osoby • Tabule 75: Struktura jednonukleotidového polymorfismu (SNP) • Tabule 76: Struktura mitochondriální DNA (mtDNA) • Tabule 77: Určení pohlaví Sekce VI.: Technologie forenzně genetické analýzy • Tabule 78: Základní kroky technologického zpracování stopy • Tabule 79: Princip organické extrakce DNA • Tabule 80: Princip vyvázání enzymatických kofaktorů • Tabule 81: FTA karty • Tabule 82: Vazba DNA na siliku • Tabule 83: Diferenciální lýza • Tabule 84: Laserová mikrodisekce (LCM) • Tabule 85: Spektrofotometrická kvantifikace • Tabule 86: Fluorimetrická kvantifikace • Tabule 87: Specifická kvantifikace – princip • Tabule 88: Specifická kvantifikace – slot blot hybridizace SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

12 SLIDE-POOL: OBSAH (6) • Tabule 89: Složení PCR směsi a denaturační fáze PCR • Tabule 90: Anelační a elongační fáze PCR • Tabule 91: Princip elektroforézy DNA • Tabule 92: Princip kapilární elektroforézy • Tabule 93: Monoplexová a multiplexová analýza STR lokusů • Tabule 94: Sekvenace asymetrickou PCR • Tabule 95: Monoplexová a multiplexová analýza SNP lokusů • Tabule 96: Mechanismy degradace DNA • Tabule 97: Klasická a miniSTR analýza • Tabule 98: Stochastické jevy Sekce VII.: Interpretace forenzně genetických dat • Tabule 99: Základní kroky procesu práce s daty Sekce VIII.: Uchovávání zdrojů genetických informací • Tabule 100: Možné formy uchovávání zdrojů genetických informací SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

13 ZÁKLADNÍ APLIKACE FORENZNÍ GENETIKY A SOUVISEJÍCÍ OBORY Sekce I. Tabule 1 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. FORENZNÍ GENETIKA kriminalistická analýza DNA identifikační analýza DNA posuzování biologické příbuznosti ??? chovatelství, zemědělství, potravinářství archeogenetika lékařská genetika

14 HISTORIE, SOUČASNOST A BUDOUCNOST FORENZNÍ GENETIKY Sekce I. Tabule 2 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. 2020 2010 2000 1990 1980 1991 – první kriminalistická DNA analýza u nás 1988 – FBI začíná užívat DNA analýzu jako důkazní metodu 1984 - britský vědec Alec Jeffreys objevil první metodu identifikace osob – DNA fingerprinting DNA fingerprinting 1995 – první DNA databáze (Velká Británie) STR analýza 2002 – spuštěna česká Národní databáze DNA automatizace a urychlení analýz analýza vysoce problematických vzorků 1998 – FBI spouští DNA databázi na systému CODIS) prediktivní analýzy určení tkáňového původu stopy určení stáří stopy rozlišení ident. dvojčat

15 CO JE BIOLOGICKÝ MATERIÁL A BIOLOGICKÁ STOPA Sekce II. Tabule 3 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. BIOLOGICKÝ MATERIÁLvše, co bylo či je součástí nebo produktem živého organismu krevspermasliznicezvířecí chlupyčásti rostlin BIOLOGICKÁ STOPAbiologický materiál zajištěný v souvislosti s kriminalisticky relevantní událostí – například na místě činu krev na střepustěr moči sliny na nedopalku

16 CHARAKTERISTIKY BIOLOGICKÉ STOPY Sekce II. Tabule 4 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. biologická stopa tkáňový původ druhový původ původce ???

17 ORIENTAČNÍ A SPECIFICKÉ ZKOUŠKY TKÁŇOVÉHO PŮVODU BM Sekce II. Tabule 5 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. ORIENTAČNÍ ZKOUŠKA pozitivní výsledek indikuje, že by se mohlo jednat o daný biologický materiál SPECIFICKÁ ZKOUŠKA pozitivní výsledek indikuje, že se prakticky s jistotou jedná o daný biologický materiál + výsledek = „může se jednat o krev“ - výsledek = „nejspíš se nejedná o krev“ C T + výsledek = „s jistotou se jedná o sperma“ - výsledek = „s jistotou se nejedná o sperma“

18 STANDARDNÍ SROVNÁVACÍ VZORKY OSOB Sekce II. Tabule 6 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. BUKÁLNÍ STĚR PERIFERNÍ KREV = otěr buněk sliznice vnitřní strany tváře • neinvazívní, neintimní • lze provést sám sobě nebo jinou poučenou osobou • snadno skladovatelný při pokojové teplotě = odběr krve ze žíly • invazívní, spojený s malou mírou rizika (infekce apod.) • musí ho provádět zdravotnický personál • obtížnější dlouhodobé uchovávání vzorku ŽIVÉ OSOBY NEHTY, KOŽNÍ SEŠKRABY nelze-li zajistit jiný materiál např. z etických důvodů

19 SPECIÁLNÍ SROVNÁVACÍ VZORKY Sekce II. Tabule 7 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. BUKÁLNÍ STĚR PERIFERNÍ KREV dle stavu těla, tj. pokročilosti degradace: SVALOVÁ TKÁŇ KOST, ZUB MRTVOLY EMBRYA, PLODY dle situace: POTRATOVÝ MATERIÁL CHORIOVÉ KLKY PLODOVÁ VODA PUPEČNÍKOVÁ KREV

20 VYHLEDÁVÁNÍ BIOLOGICKÝCH STOP Sekce II. Tabule 8 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. STOPY MARKANTNÍ, VIDITELNÉ OKEM I PŘI ZBĚŽNÉM POHLEDU STOPY VIDITELNÉ OKEM PŘI PODROBNÉM OHLEDÁNÍ STOPY NEVIDITELNÉ OKEM, DETEKOVATELNÉ SPEC. POMŮCKAMI STOPY ZCELA LATENTNÍ, ODEBÍRANÉ „NASLEPO“

21 PŘÍČINY DEGRADACE DNA Sekce II. Tabule 9 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. bakterie, plísně apod. chemikálie (oxidační činidla apod.) vlhkost UV záření vysoká teplota

22 ODBĚR BIOLOGICKÉHO MATERIÁLU Sekce II. Tabule 10 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. běžný odběrový tampón užívaný ve zdravotnictví speciální kartáčkovitý forenzní odběrový tampón

23 KONTAMINACE STOPY Sekce II. Tabule 11 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. biologická stopa – zdroj původní DNA možné zdroje kontaminující DNA: odběrové pomůcky osoby manipulující se stopami jiné stopy nebo dokonce srovnávací vzorky

24 BIOLOGICKÁ STOPA V ČASE Sekce II. Tabule 12 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. uvolnění BM z těla nanesení BM na nosič = vznik stopy postupná degradace až zánik stopy nalezení stopy při ohledání = zajištění stopy spotřebování stopy lab. analýza stopy = odběr BM ze stopy deponování zbytku stopy nebo

25 PRIMÁRNÍ A SEKUNDÁRNÍ PŘENOS BIOLOGICKÉHO MATERIÁLU Sekce II. Tabule 13 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

26 HODNOTA BIOLOGICKÉ STOPY Sekce II. Tabule 14 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. TECHNICKÁ HODNOTA STOPY TAKTICKÁ HODNOTA STOPY PROCESNÍ HODNOTA STOPY = jak je stopa po technické stránce použitelná pro analýzu = jak silně mohou závěry analýzy stopy posílit či oslabit platnost jednotlivých hypotéz o skutku při dokazování = jak silně mohou závěry analýzy stopy pomoci v dalším vyšetřování stopy s velmi malým množstvím BM, s degradovaným BM apod. stopy s velkým množstvím nedegradovaného BM stopy těsně spojené se skutkem, „usvědčující“ – např. BM z interrupce v případě pohlavního zneužívání stopy s nejasnou vazbou na skutek – např. nedopalek na chodníku před obchodem, kde došlo ke vloupání stopa umožňující nasměrování vyšetřování (např. nesoucí informaci o fyzických znacích osoby, která ji zanechala) stopa neumožňující nasměrování vyšetřování

27 STRUKTURA JEDNOŘETĚZCOVÉ DNA Sekce III. Tabule 15 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. A TT G C C trifosfát báze deoxyribóza NUKLEOTID

28 STRUKTURA DVOUŘETĚZCOVÉ DNA Sekce III. Tabule 16 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. A A A T T T G G G C C C

29 DALŠÍ STUPNĚ USPOŘÁDÁNÍ DNA Sekce III. Tabule 17 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. dvoušroubovice DNA (dsDNA) nukleozóm 30 nm vlákno chromatida

30 KARYOTYP Sekce III. Tabule 18 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. buněčné jádro 2 párové chromozómy

31 GENETICKÝ KÓD Sekce III. Tabule 19 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. A A A G G T T CC serin alanin glycin

32 REPLIKACE – TRANSKRIPCE – TRANSLACE Sekce III. Tabule 20 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. DNA RNAbílkovina replikacetranskripcetranslace

33 GEN – LOKUS – MARKER Sekce III. Tabule 21 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. POJMY UŽÍVANÉ K OZNAČENÍ MÍST V DNA GEN = funkční úsek DNA, jehož určitá část je překládána do struktury bílkovin a ostatní části se tohoto překladu nějakým způsobem účastní LOKUS = libovolný adresný úsek DNA či místo v DNA, a to libovolného rozsahu i funkce MARKER = úsek DNA (ať už v genu či extragenové DNA), který je předmětem testování

34 DNA V LIDSKÉ BUŇCE Sekce III. Tabule 22 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. mitochondrie obsahující kruhovou DNA buněčné jádro s chromozómy

35 PŘÍČINY VARIABILITY Sekce III. Tabule 23 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. GENETICKÉEPIGENETICKÉENVIRONMENTÁLNÍ = v genech = v regulaci = v prostředí výsledná podoba znaku – fenotyp – je dán kombinací všech těchto zdrojů variability

36 POLYMORFISMUS A VARIABILITA LOKUSŮ V DNA Sekce III. Tabule 24 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. nepolymorfní lokus nízce polymorfní lokus vysoce polymorfní lokus

37 MITÓZA (MITOTICKÉ DĚLENÍ) Sekce III. Tabule 25 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

38 MEIÓZA (REDUKČNÍ DĚLENÍ) Sekce III. Tabule 26 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

39 OPLOZENÍ Sekce III. Tabule 27 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

40 DĚDIČNOST AUTOZOMÁLNÍCH LOKUSŮ Sekce III. Tabule 28 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. homozygotheterozygot

41 DĚDIČNOST Y–CHROMOZOMÁLNÍCH LOKUSŮ Sekce III. Tabule 29 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. Y Y Y Y Y Y XX X X XX Y Y X

42 DĚDIČNOST X–CHROMOZOMÁLNÍCH LOKUSŮ Sekce III. Tabule 30 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. X X X X X X X X X X X X X X X X hemizygothomozygotheterozygothemizygot X X X X Y Y Y X X X X Y

43 DĚDIČNOST MITOCHONDRIÁLNÍ DNA Sekce III. Tabule 31 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

44 INDIVIDUALITA A IDENTIFIKACE Sekce IV. Tabule 32 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. vysoce polymorfní lokus 1 vysoce polymorfní lokus 2 vysoce polymorfní lokus 3 vysoce polymorfní lokus 4 vysoce polymorfní lokus 5 vysoce polymorfní lokus 6 vysoce polymorfní lokus 7 testováním většího množství vysoce polymorfních lokusů lze dosáhnout individuální identifikace genetického jedince

45 GENETA A RAMETA Sekce IV. Tabule 33 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. oplozením vajíčka spermií vzniká ZYGOTA GENETA = genetický jedinec = soubor všech buněk odvozených z jedné zygoty RAMETA = fyzický jedinec = prostorově ohraničený jedinec, jedinec jako funkční jednotka

46 MODULÁRNÍ A UNITÁRNÍ ORGANISMY Sekce IV. Tabule 34 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. MODULÁRNÍ ORGANISMY UNITÁRNÍ ORGANISMY • tělo složeno z opakujících se modulů • růst obvykle neukončený • oddělený modul může dát vzniknout novému fyzickému jedinci • jeden genetický jedinec může být vyjádřen jako mnoho jedinců fyzických • tělo složeno z unikátních neopakujících se částí (orgánů) • růst ukončený – organismus prochází životními etapami • oddělená část nemůže dát vzniknout novému fyzickému jedinci • jeden genetický jedinec je obvykle vyjádřen jako jeden jedinec fyzický

47 GENETICKÝ PROFIL OSOBY Sekce IV. Tabule 35 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

48 GENETICKÁ INFORMACE JEDNOVAJEČNÝCH DVOJČAT Sekce IV. Tabule 36 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. vysoce polymorfní lokus 1 vysoce polymorfní lokus 2 vysoce polymorfní lokus 3 vysoce polymorfní lokus 4 vysoce polymorfní lokus 5 vysoce polymorfní lokus 6

49 GENETICKÁ INFORMACE DVOJVAJEČNÝCH DVOJČAT Sekce IV. Tabule 37 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. vysoce polymorfní lokus 1 vysoce polymorfní lokus 2 vysoce polymorfní lokus 3 vysoce polymorfní lokus 4 vysoce polymorfní lokus 5 vysoce polymorfní lokus 6

50 GENETICKÁ INFORMACE CHIMÉRICKÉHO JEDINCE Sekce IV. Tabule 38 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. vysoce polymorfní lokus 1 vysoce polymorfní lokus 2 vysoce polymorfní lokus 3 vysoce polymorfní lokus 4 vysoce polymorfní lokus 5 vysoce polymorfní lokus 6

51 SMĚNA BUNĚK MEZI DVOJVAJEČNÝMI DVOJČATY Sekce IV. Tabule 39 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. částečným propojením krevních oběhů dochází ke směně krvetvorných buněk kostní dřeň trvale obsahuje malé množství krvetvorných buněk dvojčete

52 MATERNÁLNÍ A FETÁLNÍ MIKROCHIMÉRISMUS Sekce IV. Tabule 40 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. na placentě může docházet k přestupu buněk plodu do těla matky a obráceně tělo matky trvale obsahuje buňky dítěte (fetální mikrochimérismus) a tělo dítěte buňky matky (maternální mikrochimérismus)

53 POSTTRANSPLANTAČNÍ CHIMÉRISMUS - BMT Sekce IV. Tabule 41 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. PACIENT DÁRCE likvidace vlastní kostní dřeně chemoterapií transplantace dárcovy kostní dřeně odběr dárcovy kostní dřeně tělo pacienta trvale obsahuje kostní dřeň dárce; genetický profil buněk kostní dřeně a buněk od nich odvozených je identický s genetickým profilem dárce

54 OČEKÁVANÁ SHODA U DVOJICE MATKA – DCERA Sekce IV. Tabule 42 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. 50 % autozomální DNA je shodné původem obě mají po dvou X chromozómech, z toho jeden je shodný původem nemají Y-chromozóm mitotyp je shodný původem

55 OČEKÁVANÁ SHODA U DVOJICE MATKA – SYN Sekce IV. Tabule 43 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. 50 % autozomální DNA je shodné původem matka má dva X chromozómy, syn jeden, a to shodný původem s jedním z matčiných X chromozómů matka nemá Y-chromozóm mitotyp je shodný původem

56 OČEKÁVANÁ SHODA U DVOJICE OTEC – DCERA Sekce IV. Tabule 44 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. 50 % autozomální DNA je shodné původem dcera má dva X chromozómy, otec jeden, a to shodný původem s jedním z dceřiných X chromozómů dcera nemá Y-chromozóm mitotyp není shodný původem

57 OČEKÁVANÁ SHODA U DVOJICE OTEC – SYN Sekce IV. Tabule 45 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. 50 % autozomální DNA je shodné původem otec i syn mají po jednom X chromozómu, tyto nejsou shodné původem otec i syn mají po jednom Y chromozómu, tyto jsou shodné původem mitotyp není shodný původem

58 OČEKÁVANÁ SHODA U DVOJICE SESTRA – SESTRA Sekce IV. Tabule 46 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 50 % autozomální DNA je shodné původem obě mají po dvou X chromozómech, jeden nebo oba jsou shodné původem nemají Y-chromozóm mitotyp je shodný původem

59 OČEKÁVANÁ SHODA U DVOJICE SESTRA – BRATR Sekce IV. Tabule 47 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 50 % autozomální DNA je shodné původem sestra má dva X chromozómy, bratr jeden, tento může a nemusí být shodný původem s jedním ze sestřiných X chromozómů sestra nemá Y-chromozóm mitotyp je shodný původem

60 OČEKÁVANÁ SHODA U DVOJICE BRATR – BRATR Sekce IV. Tabule 48 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 50 % autozomální DNA je shodné původem oba mají po jednom X chromozómu, tyto mohou a nemusí být shodné původem oba mají po jednom Y chromozómu, tyto jsou shodné původem mitotyp je shodný původem

61 OČEKÁVANÁ SHODA U DVOJICE BABIČKA Z MATČINY STRANY – VNUČKA Sekce IV. Tabule 49 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem obě mají po dvou X chromozómech, z toho jeden může a nemusí být shodný původem nemají Y-chromozóm mitotyp je shodný původem

62 OČEKÁVANÁ SHODA U DVOJICE BABIČKA Z MATČINY STRANY – VNUK Sekce IV. Tabule 50 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem babička má dva X chromozómy, vnuk jeden, tento může a nemusí být shodný původem s jedním z babiččiných X chromozómů babička nemá Y-chromozóm mitotyp je shodný původem

63 OČEKÁVANÁ SHODA U DVOJICE DĚDEČEK Z MATČINY STRANY – VNUČKA Sekce IV. Tabule 51 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem vnučka má dva X chromozómy, dědeček jeden, tento může a nemusí být shodný původem s jedním z vnuččiných X chromozómů vnučka nemá Y-chromozóm mitotyp není shodný původem

64 OČEKÁVANÁ SHODA U DVOJICE DĚDEČEK Z MATČINY STRANY – VNUK Sekce IV. Tabule 52 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem oba mají po jednom X chromozómu, tyto mohou a nemusí být shodné původem oba mají po jednom Y chromozómu, tyto nejsou shodné původem mitotyp není shodný původem

65 OČEKÁVANÁ SHODA U DVOJICE BABIČKA Z OTCOVY STRANY – VNUČKA Sekce IV. Tabule 53 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem obě mají po dvou X chromozómech, z toho jeden je shodný původem nemají Y-chromozóm mitotyp není shodný původem

66 OČEKÁVANÁ SHODA U DVOJICE BABIČKA Z OTCOVY STRANY – VNUK Sekce IV. Tabule 54 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem babička má dva X chromozómy, vnuk jeden, tento není shodný původem ani s jedním z babiččiných X chromozómů babička nemá Y-chromozóm mitotyp není shodný původem

67 OČEKÁVANÁ SHODA U DVOJICE DĚDEČEK Z OTCOVY STRANY – VNUČKA Sekce IV. Tabule 55 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem vnučka má dva X chromozómy, dědeček jeden, tento není shodný původem ani s jedním z vnuččiných X chromozómů vnučka nemá Y-chromozóm mitotyp není shodný původem

68 OČEKÁVANÁ SHODA U DVOJICE DĚDEČEK Z OTCOVY STRANY – VNUK Sekce IV. Tabule 56 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem oba mají po jednom X chromozómu, tyto nejsou shodné původem oba mají po jednom Y chromozómu, tyto jsou shodné původem mitotyp není shodný původem

69 OČEKÁVANÁ SHODA U DVOJICE NEVLASTNÍCH SESTER (SPOLEČNÁ MATKA) Sekce IV. Tabule 57 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem obě mají po dvou X chromozómech, z toho jeden nebo žádný je shodný původem nemají Y-chromozóm mitotyp je shodný původem

70 OČEKÁVANÁ SHODA U DVOJICE NEVLASTNÍCH SESTER (SPOLEČNÝ OTEC) Sekce IV. Tabule 58 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem obě mají po dvou X chromozómech, z toho jeden je shodný původem nemají Y-chromozóm mitotyp není shodný původem

71 OČEKÁVANÁ SHODA U DVOJICE NEVLASTNÍ SESTRA A BRATR (SPOLEČNÁ MATKA) Sekce IV. Tabule 59 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem sestra má dva X chromozómy, bratr jeden, tento může a nemusí být shodný původem s jedním ze sestřiných X chromozómů sestra nemá Y-chromozóm mitotyp je shodný původem

72 OČEKÁVANÁ SHODA U DVOJICE NEVLASTNÍ SESTRA A BRATR (SPOLEČNÝ OTEC) Sekce IV. Tabule 60 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem sestra má dva X chromozómy, bratr jeden, tyto nejsou shodné původem sestra nemá Y-chromozóm mitotyp není shodný původem

73 OČEKÁVANÁ SHODA U DVOJICE NEVLASTNÍCH BRATRŮ (SPOLEČNÁ MATKA) Sekce IV. Tabule 61 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem oba mají po jednom X chromozómu, tyto mohou a nemusí být shodné původem oba mají po jednom Y chromozómu, tyto nejsou shodné původem mitotyp je shodný původem

74 OČEKÁVANÁ SHODA U DVOJICE NEVLASTNÍCH BRATRŮ (SPOLEČNÝ OTEC) Sekce IV. Tabule 62 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. v průměru 25 % autozomální DNA je shodné původem oba mají po jednom X chromozómu, tyto nejsou shodné původem oba mají po jednom Y chromozómu, tyto jsou shodné původem mitotyp není shodný původem

75 RODOKMEN – STUPEŇ PŘÍBUZNOSTI Sekce IV. Tabule 63 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

76 RODOKMEN – DĚDIČNOST AUTOZOMÁLNÍCH LOKUSŮ Sekce IV. Tabule 64 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

77 RODOKMEN – DĚDIČNOST X–CHROMOZOMÁLNÍCH LOKUSŮ Sekce IV. Tabule 65 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

78 RODOKMEN – DĚDIČNOST Y–CHROMOZOMÁLNÍCH LOKUSŮ Sekce IV. Tabule 66 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

79 RODOKMEN – DĚDIČNOST MITOCHONDRIÁLNÍ DNA Sekce IV. Tabule 67 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

80 RODOKMEN – KONSANGVINITA A INCEST Sekce IV. Tabule 68 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. otec matka syn poloviční sestra = manželka otcova milenka snacha vnuk pravnučka dědeček babička dědečekbabička výchozí osoba (proband) muž žena 1/4 9/16 1/4 5/16 0 1/4 5/80 0 5/16 5/32 pradědečekprababička osoby s vyznačeným podílem genetické informace shodné s probandem 5/32 1/4 konsangvinní vztah incestní vztah kryptický vztah

81 RODOKMEN – MNOHOTNÝ INCEST Sekce IV. Tabule 69 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. sestřenice dcera + incestní partnerka otec matka strýcnebiologická teta výchozí osoba (proband) muž žena 1/4 1/8 1/20 1/4 9/16 25/32 57/64 dědečekbabička osoby s vyznačeným podílem genetické informace shodné s probandem 5/32 1/4 konsangvinní vztah incestní vztah vnučka + dcera + incestní partnerka syn + vnuk + pravnuk

82 RODOKMEN – ANCESTRY INFORMATIVE MARKERS Sekce IV. Tabule 70 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. mitotyp Y-haplotyp set SNP AIMS

83 PREDIKCE FENOTYPOVÝCH ZNAKŮ Sekce IV. Tabule 71 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. Dobře predikovatelné pomocí analýzy SNP jsou pigmentační charakteristiky: Dosud prakticky nepredikovatelné jsou např. tělesná výška či tvar obličeje:

84 STRUKTURA KRÁTKÉ TANDEMOVÉ REPETICE (STR) Sekce V. Tabule 72 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. T T A A T A G C T T A A T A G C T T A A T A G C T T A A T A G C KRÁTKÁ TANDEMOVÁ REPETICE tvořená několikerým opakováním základního motivu KONSTANTNÍ SEKVENCE

85 ALELY STR LOKUSU – STANDARDNÍ A MIKROVARIANTNÍ Sekce V. Tabule 73 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. alela 7 KONSTANTNÍ SEKVENCE alela 8 alela 7.2 alela 7.2 (jiná varianta) T T A A T A G C T A G C T T A A T A G C

86 SROVNÁNÍ GENOTYPU STOPY A OSOBY Sekce V. Tabule 74 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. BIOLOGICKÁ STOPA GENOTYP TESTOVANÉHO STR LOKUSU: 11/15 OSOBA „B“ není původcem stopy GENOTYP TESTOVANÉHO STR LOKUSU: 12/15 OSOBA „C“ není původcem stopy GENOTYP TESTOVANÉHO STR LOKUSU: 11/15 OSOBA „A“ původce stopy GENOTYP TESTOVANÉHO STR LOKUSU: 11/15 zákonitá shoda (osoba je původcem stopy, tj. profil bude téměř s jistotou shodný) náhodná shoda (osoba má koincidencí stejný genotyp jako skutečný původce) neshoda

87 STRUKTURA JEDNONUKLEOTIDOVÉHO POLYMORFISMU (SNP) Sekce V. Tabule 75 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. T A T A T A G C T T A A T A G C T A T A T A G C T A T A G C C G JEDNONUKLEOTIDOVÝ POLYMORFISMUS (SNP)

88 STRUKTURA MITOCHONDRIÁLNÍ DNA (MTDNA) Sekce V. Tabule 76 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. ORI H replikační počátek těžkého řetězce mtDNA HYPERVARIABILNÍ OBLASTI 1, 2 a 3 obsahují četné: ATTACGCTACGCATTCAAGTCCCCATGGATTACAGTAGTTC ATTACGCTAGGCATTCAAGTCCCCCATGGATTACGTAGTTC substituce inzercedelece

89 URČENÍ POHLAVÍ Sekce V. Tabule 77 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. MUŽSKÁ BUŇKAŽENSKÁ BUŇKA X-chromozómY-chromozómdva X-chromozómy část genu pro amelogenin 6 bp

90 ZÁKLADNÍ KROKY TECHNOLOGICKÉHO ZPRACOVÁNÍ STOPY Sekce VI. Tabule 78 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

91 PRINCIP ORGANICKÉ EXTRAKCE DNA Sekce VI. Tabule 79 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. organická fáze s nepolárními látkami vodná fáze s polárními látkami včetně DNA mezifáze s bílkovinami

92 PRINCIP VYVÁZÁNÍ ENZYMATICKÝCH KOFAKTORŮ Sekce VI. Tabule 80 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. stabilní roztok obsahující DNA chelatační činidlo vyvazující enzymatické kofaktory

93 FTA KARTY Sekce VI. Tabule 81 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. DNA je imobilizována a vázána na celulózová vlákna

94 VAZBA DNA NA SILIKU Sekce VI. Tabule 82 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

95 DIFERENCIÁLNÍ LÝZA Sekce VI. Tabule 83 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. slaběji lyzující roztok silněji lyzující roztok IZOLÁT DNA Z EPITELIÍ „ŽENSKÁ FRAKCE“ IZOLÁT DNA ZE SPERMIÍ „MUŽSKÁ FRAKCE“

96 LASEROVÁ MIKRODISEKCE (LCM) Sekce VI. Tabule 84 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. pomocí laserového paprsku jsou vyříznuty požadované buňky (např. spermie) pomocí světelného pulzu jsou vyříznuté buňky přeneseny do víčka zkumavky

97 SPEKTROFOTOMETRICKÁ KVANTIFIKACE Sekce VI. Tabule 85 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

98 FLUORIMETRICKÁ KVANTIFIKACE Sekce VI. Tabule 86 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. Na/do DNA se naváže fluorescenční barvivo CCD DETEKTOR SVĚTELNÝ ZDROJ Po excitaci laserem navázané fluorescenční barvivo září Čím více je DNA ve vzorku, tím více barviva se naváže a tím více vzorek září:

99 SPECIFICKÁ KVANTIFIKACE – PRINCIP Sekce VI. Tabule 87 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

100 SPECIFICKÁ KVANTIFIKACE – SLOT BLOT HYBRIDIZACE Sekce VI. Tabule 88 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. 0,15 0,3 0,6 1,2 2,5 5 10 neznámé (měřené) vzorky kalibrační řada (vzorky známých koncentrací)

101 SLOŽENÍ PCR SMĚSI A DENATURAČNÍ FÁZE PCR Sekce VI. Tabule 89 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

102 ANELAČNÍ A ELONGAČNÍ FÁZE PCR Sekce VI. Tabule 90 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena.

103 PRINCIP ELEKTROFORÉZY DNA Sekce VI. Tabule 91 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. + _ + _ Vzorek obsahuje směs DNA fragmentů různé délky Po vložení napětí se fragmenty začnou gelem pohybovat k anodě Fragmenty se v gelu rozdělí podle své délky

104 PRINCIP KAPILÁRNÍ ELEKTROFORÉZY Sekce VI. Tabule 92 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. + _ + _ Vzorek s fluorescenčně značenými DNA fragmenty různé délky putuje skleněnou kapilárou naplněnou polymerem Při průchodu fragmentu detekčním okénkem vyvolá laser silnou fluorescenci, která je zaznamenána CCD detektorem čas T 1 čas T 2 čas T 3 T1T1 T2T2 T3T3 V časovém záznamu elektroforézy – elektroforetogramu – se zvýšení fluorescence projeví jako tzv. pík + _

105 MONOPLEXOVÁ A MULTIPLEXOVÁ ANALÝZA STR LOKUSŮ Sekce VI. Tabule 93 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. 100 bp120 bp200 bp180 bp140 bp225 bp 80 bp 60 bp 158 bp194 bp Monoplex – analýza jediného STR lokusu Multiplex – analýza několika STR lokusů lokus 1lokus 2lokus 3lokus 4lokus 5lokus 6

106 SEKVENACE ASYMETRICKOU PCR Sekce VI. Tabule 94 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. + _ + _ Produktem sekvenační reakce je směs fragmentů lišících se o 1 bp; fragmenty se při elektroforéze v kapiláře rozdělí dle své délky – prochází tedy „fragment za fragmentem“ Fluorescence každého fragmentu je zaznamenána CCD detektorem; detektor rozliší různou barvu fluorescence Fluorescenční barva, kterou byl značen fragment, odpovídá typu nukleotidu; barva píků tak může být převedena na sekvenci nukleotidů + _ C T G C T T A C A T G C C A A C G G A C T T G C A T C A A C T G C G A

107 MONOPLEXOVÁ A MULTIPLEXOVÁ ANALÝZA SNP LOKUSŮ Sekce VI. Tabule 95 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. Monoplex – analýza jediného SNP lokusu Multiplex – analýza několika SNP lokusů C T lokus 1lokus 2lokus 3lokus 4 C T TCC

108 MECHANISMY DEGRADACE DNA Sekce VI. Tabule 96 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. T T A A T A G C T T A A A G C T T A A T A C T A A T A T T A A T A G CC T T A A T A G A G C T A T A T T T A A T A G C Narušení struktury DNA Fragmentace DNA A T T

109 KLASICKÁ A MINISTR ANALÝZA Sekce VI. Tabule 97 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. STR primer F primer R primer F primer R větší délka vznikajícího fragmentu co nejmenší délka vznikajícího fragmentu standardní STR analýza miniSTR analýza

110 STOCHASTICKÉ JEVY Sekce VI. Tabule 98 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. lokus 1lokus 2lokus 3lokus 4lokus 5lokus 6 nerovnováha píků u heterozygota alelický drop-out lokusový drop-out zvýšení stutteringu alelický drop-in STANDARDNÍ PROFIL LT-DNA PROFIL

111 ZÁKLADNÍ KROKY PROCESU PRÁCE S DATY Sekce VII. Tabule 99 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. data z genotypizace posouzení kvality statistické hodnocení dat znalecký posudek znalecký posudek další informace k případu ?

112 MOŽNÉ FORMY UCHOVÁVÁNÍ ZDROJŮ GENETICKÝCH INFORMACÍ Sekce VIII. Tabule 100 SLIDE-POOL FORENZNÍ GENETIKY – soubor obrazových schémat Výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080 – „4n6gen – vzdělávání v oblasti forenzní genetiky“. Projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky a realizován Československou společností pro forenzní genetiku. Autorka schémat: Mgr. Halina Šimková. Všechna práva vyhrazena. biologická stopa biologický materiál izolát DNADNA profil banka biologického materiálu či celých stop banka izolátů DNA DNA databáze

Stáhnout ppt "SLIDE-POOL FORENZNÍ GENETIKY rozšířený soubor obrazových schémat k publikaci Breviář forenzní genetiky výukový materiál grantového projektu CZ.1.07/2.3.00/09.0080."

Podobné prezentace

Reklamy Google