Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce.

Podobné prezentace


Prezentace na téma: "TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce."— Transkript prezentace:

1 TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce

2 Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dGMP)

3 “Koncept párování bazí je striktně konzervativní“ CytosineGuanine

4 Deoxyribosa a fosfát dávají DNA řetězci směr  konce dsDNA nejsou stejné  jednotlivé řetězce duplexu jsou k sobě komplementární  DNA rětězce duplexu mohou být denaturována a znovu spojena OH HO T AG T A C G C 5’ end3’ end 5’ end 3’ end

5 T m (melting temperature) je teplota při které je dsDNA z poloviny denaturována Tm je závislá na:  složení bazí  rozpouštědle  iontové síle  pH  délce DNA

6 DNA replikace in vivo vyžaduje několik enzymů  separace řetězců  syntéza krátkých RNA primerů  syntéza dvou nových DNA helixů  podílí se enzymy: DNA primasa helikasa DNA polymerasa DNA ligasa SSB-proteiny

7 Vlastnosti DNA polymerasy polymerasová aktivita 1. polymerasová aktivita  Replikace probíhá vždy ve směru od 5´na 3´konec  Nový nukleotid je přidáván tedy vždy na 3´OH konec. 3'-5' exonukleasová aktivita 2. 3'-5' exonukleasová aktivita -opravná funkce “proofreading” 5´exonukleasová aktivita 3. 5´exonukleasová aktivita - odštěpuje RNA primer

8 DNA replikace in vitro vyžaduje pouze jeden enzym 1957 Arthur Kornberg dokázal existenci DNA polymerasy - DNA polymerase I in vitro polymerasa vyžaduje pouze: 4 deoxynukleotidy trifosfáty dsDNA templát primer - ssDNA nebo RNA s volnou 3'-OH FUNKCE OSTATNÍCH PROTEINů JE in vitro NAHRAZENA ZMĚNOU TEPLOT DNA Polymerasa

9 Syntéza obou řetězců specifické dsDNA in vitro TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 5’ 3’ 5’ TTGAGAAAGGAATAAGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3’ 5’ 3’ Forward primer TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 5’ 3’ 5’ DNA POL dNTPs

10 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 5’ 3’ 5’ TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC TCTTTAGCTCATATACG 3’ 5’ 3’ Reverse primer TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 5’ 3’ 5’ dNTPs DNA POL GCATATACTCGATTTCT 5’ 3’ Syntéza obou řetězců specifické dsDNA in vitro

11 PCR: Co to je?  Polymerase Chain Reaction: znamená amplifikace (mnohonásobná replikace) relativně krátkých úseků specifické DNA  Základní nástroj molekulární biologie se vzrůstájícím významem i v dalších oborech (botanika, kriminalistika)  The idea  Ghobind Khorana 1971  Kary Mullis 1983 poprvé provedená mnohonásobná in vitro replikace ve zkumavce Nobelova cena 1993

12  Řetězová reakce vychází z DNA replikace  Spočívá v opakování cyklů denaturace (separace dsDNA), navázání primerů a elongace primerů (syntéza nového vlákna DNA) pomocí změn teploty  potřeba silného enzymu (polymerasy) který je schopen pracovat při vysokých teplotách  termofilní organismy objeveny začátkem 70tých let Jak funguje PCR

13  Polymerasa izolovaná z termofilní baktérie (Thermus aquaticus, Pyrococcus furiosus) zkr. TAQ, PFU Polymerasa Jak funguje PCR TERMOSTABILNÍ POLYMERASY až s objevem a použitím TERMOSTABILNÍ POLYMERASY získala PCR na významu

14 Praktické provedení PCR  Počáteční denaturace 94 o C 3-5 min  denaturace 94 o C 30 sec  annealing ~55 o C 30 sec prodlužování 72 o C 1min/kilobáze  počet cyklů x

15 Praktické provedení PCR agarozová elektroforéza

16 PCR komponenty  Templátová DNA  vzorek k amplifikaci  Primery  krátké specifické úseky DNA zaručující specifitu amplifikace  dATP, dTTP, dCTP, dGTP  volné stavební jednotky DNA  Thermostabilní DNA polymerasa (e.g., Taq, Pfu)  Pufr a soli (KCl, MgCl 2 )

17 Proces PCR Velký nadbytek primeru, dNTPs a Taq POL k DNA templátu

18 Problémy:  PCR je velmi citlivá na kontaminace  Častý problém - nespecifická amplifikace  Polymerasa pracuje i při nízkých teplotách (e.g., během nastavování reakce)  “Hot start” PCR je řešení (protilátka proti Taq)  Amplifikace je často možná i pro ne zcela známou sekvenci primerů např. DNA jiného biologického druhu  “Degenerované primery” (multiple verze s různými bázemi v klíčové pozici (tryptofan + methionin): stupeň degenerace: prettyfly protein má kód degenerovaný na 11 pozicích tzn. (4)(2)(4)(2)(4)(4)(2)(2)(2)(4)(2) = krát  “Touchdown PCR” s vyšší přesností v prvních cyklech  Maximální velikost produktu +/-5000 bazí pro standardní PCR: Long PCR kits mohou amplifikovat až 35 kbazí P R E T T Y F L Y CCA CGA GAA ACA ACA TAC TTC CTA TAC G G G G G T T G T C C C C C T T T T T A T

19 Navrhování primerů  Primery by měly být bazí dlouhé  Nutná znalost alespoň části sekvence amplifikované DNA  3’ konec primeru je důležitý: vhodné aby zde byla G nebo C báze  Procentuální zastoupení G + C by mělo být 50-60% - ovlivňuje Tm (teplota kdy se váže primer na templát)  Primery v jedné reakci by měly mít srovnatelné Tm  Vyvarovat se repetitivním sekvencím  Vyvarovat se komplementaritě uvnitř či mezi primery Tm = (G+C)x4 + (A+T)x2  degenerované primery max. 20 bp  ideální do degenerace 250x

20 Navrhování primerů Příklad navržení primerů: Konvence: DNA se vždy zapisuje ve směru od 5´ku 3´konci Cílová sekvence: (priming místo podtrženo): 5’ TATAAGCCATAACGATATTGCTGAGTCAAGTCCACATATCATATGGATGAG AAATGCTTGTGGAGCTGATGTTGATTTGGAGAGACTCTCTCTCTCTCTCTCT CTCTCTCTCTCTCTCTCTCAAACCAGTTAAAGAGTGTGCCAGTAGAG 3’ Forward Primer: 5’ ATG GAT GAG AAA TGC TTG TG 3 ’ Reverse Primer: 5’ ACT GGC ACA CTC TTT AAC TGG 3 ’

21 Praktické provedení PCR objem v mikrozkumavce: ųL složení: Templátová DNA ng Primery pmols 10mM Tris-CL pH 9.0, 50 mM KCl MgCl mM 50 ųM každého nukleotidu dATP, dGTP, dTTP, dCTP 2 jednotky Taq polymerasy

22 Praktické provedení PCR  PCR se provádí v termocyklerech kovový blok z ušlechtilého kovu snadné programování vyhřívané víko

23 PCR Optimalizace nízká nespecificky vysoká nízká specifická amplifikace vysokáFormamid pH nízkáEnzym, Primer nízkáKCl nízkáMgCl 2 vysokáAnnealingTeplota - Tm nespecifická amplifikace Složka Nespecifická amplifikace látky ovlivňující kvalitu PCR: formamid, DMSO, betain atd. pro GC-rich templáty

24 Základní typy PCR RT PCR (reverse transcriptase PCR)  vlastní PCR předchází syntéza cDNA z mRNA pomocí RT  jako primer sloužíGSP (gene specific primer) oligo dT random hexamer primer  hledání nových genů  tvorba cDNA knihoven  hledání mutací  zjišťování síly exprese různých genů

25  vychází z RT-PCR  používá se k hledání celé sekvence nového genu  nutná alespoň částečná znalost sekvence hledaného genu  vhodné pro klonování genů a jeho následnou funkční expresi (GMO) RACE PCR (rapid amplification of cDNA ends)

26

27 inverzní PCR  Amplifikace neznámých segmentů DNA

28 asymetrická PCR  sekvenace DNA, příprava hybridizačních sond  amplifikuje pouze jeden řetězec dsDNA jednozkumavková reakce PCR s jedním primerem a dideoxyribonukleotidy (ddATP, ddGTP, ddCTP, ddTTP) dideoxyribonukleotidy značené 4 fluorescenčními markery velice citlivé elektroforetické rozdělení v kapiláře fluorometr s automatickým vyhodnocením SEKVENCOVÁNÍ DNA automatické sekvenátory využívající asymetrické PCR

29 multiplex PCR  více amplifikací v jedné zkumavce  lékařská diagnostika nested PCR  2 po sobě jdoucí PCR  zvyšování specificity PCR

30 LA-PCR (long and accurate)  amplifikace dlouhých úseků, polymerasové kokteily – např. Taq + Pfu polymerasa (180:1)  Pwo polymerasa z Pyroccocus woesei  DeepVent® polymerasa z Termococcus litoralis (hlubokomořská baktérie) PROCESIVITA: jak dlouho se enzym udrží na vlákně STABILITA: kolik minut při denaturační teplotě např Taq 9 min při 97.5 °C Pwo 2 hod při 100 °C DeepVent® 8hod při 100 °C

31 in situ RT PCR  lokalizace translace a exprese genů

32 real time PCR  slouží k přesné kvantifikaci amplifikovaného produktu  využití fluorescence interkalačních barviv (etBr)  fluorimetr je součástí termocykleru  Real-time PCR monitoruje fluorescenci uvolňovanou jako odezvu na každý uskutečněný cyklus v PCR (v reálném čase). + daleko přesnější oproti end-point barvení EtBr při konvenční PCR - náročné na optimalizaci a vybavení

33 aplikace REAL-TIME PCR 1) absolutní kvantifikace množství DNA ve vzorku k externímu standardu, detekce virální či bakteriální DNA, forenzní chemie 2) koncová detekce SNP genotypizace, detekce mutací a polymorfismů 3) relativní kvantifikace srovnání úrovně exprese mRNA nebo mikroRNA mezi různými tkáněmi či biologickými podmínkami

34 princip měření vznikající fluorescence po každém cyklu PCR, stanovení křivek tání

35 chemismus interkalace barviva na dvoušroubovici vznikající (amplifikované) DNA precizní výběr primerů – nesmí vytvářet dimery nutná kontrola amplifikovaného produktu na křivku denaturačních teplot 1) interkalační barviva SYBRgreen

36 chemismus uvolňování fluorescence po degradaci sondy nutná 5´-3´exonukleasová aktivita Taq polymerasy fluorescenční značka: VIC, FAM (fluorescein) zhášeč: Tamra (Tetramethyl-6-Carboxyrhodamine) 2) hybridizační sondy (TAQman) FRET = Förster/fluorescence resonance energy transfer

37 TaqManSybrGreen specifitaprimery proba PCR podmínky primery PCR podmínky flexibilitasingleplex multiplex (max.4) singleplex aplikacekvantifikace SNP detekce kvantifikace cenavysokánízká srovnání

38 kontaminace největší problém PCR aerosol, pipety, staré amplikony částečné řešení URACIL N-GLYKOSYLASA  štěpí ss a dsDNA s inkorporovaným deoxyuracilem (dUTP)  termolabilní, 0% aktivita nad 55◦C  nereaguje s templátem (dTTP)  dUTP v qPCR mixu místo dTTP  pracuje během nastavení PCR reakce

39 chyby v pipetování templát (cDNA) premix (primery, proba, polymerasa, dNTP, pufr, srovnávací fluorescenční barvivo) částečné řešení - ROX fluorescence se nemění během PCR cyklů a vzrůstající fluorescence v každé zkumavce vzorku je extrapolována na srovnávací

40 lineární vynesení logaritmické vynesení

41 lineární ~20 do ~1500

42 C T hodnoty C T počet cyklů při kterém fluorescence vzorku překročí threshold (prahovou hodnotu) treshold je třeba nastavit tak aby u každého vzorku procházel lineární části křivky

43 před každou kvantifikací je třeba vždy udělat standardní křivku – absolutní kvantifikace templát: 10x ředění buď přímo cDNA, nebo plasmid s naklonovaným genem, který stanovujeme CTCT koncentrace templátu

44 PARAMETRY STANDARDNÍ KŘIVKY směrnice: ideální -3,32 = 100% efektivita reakce %EFF – kolik kopii templátu je zkopírováno v každém cyklu R 2 korelační koeficient (tolerovat se dá ještě 0,995)

45 %EFF 100%= 2.00x 90%= 1.90x 80% = 1.80x 70% = 1.70x relativní kvantifikace je možná pouze pokud sledovaný gen a referenční gen má srovnatelnou a vysokou efektivitu > 90%  3%

46 REFERENČNÍ GEN relativní kvantifikace musí mít stabilní expresi ve všech studovaných vzorcích nejčastěji provozní geny (house-keeping) actin, GAPDH, cyklofilin, 18S RNA

47 TaqMan Human Endogenous Control Plate CTCT

48  C T = 2 čtyřnásobný rozdíl v expresi změna v jednom cyklu při 100% efektivitě je rovna dvounásobné změně ve výchozí koncentraci cDNA 18S ribosomální RNA přepisována jinou RNA polymerasou než mRNA byly popsány výkyvy mezi množstvím rRNA a mRNA nelze použít pokud se vychází z mRNA

49 vyhodnocení GAPDH GOI kalibrátor sample 2sample 1 izolace celkové RNA (mRNA) přepis do cDNA navržení primerů a sond pro referenční gen a studovaný (GOI) určení standardních křivek pro oba geny a stanovení efektivity GAPDH GOI GAPDH GOI

50 vyhodnocení kalibrátor GOI sample A sample B kalibrátor sample A sample B GAPDH

51 vyhodnocení změny exprese pro sample 1 metoda „delta delta cé té“ 1.určíme C T pro všechny křivky 2.určíme C T GOI - C T GAPDH pro kalibrátor  C T kalibrátor 3. určíme C T GOI - C T GAPDH pro sample 1  C T sample 1 4.  C Tsample 1 -  C Tkalibrátor  C T výsledek (kolikrát je gen více či méně exprimován) 2 -  CT 1

52 vyhodnocení počítá se i s efektivitou Sample A - kalibrátor Sample B - vzorek 2

53 vyhodnocení 3 pomocí standardů o známe koncentraci se spočítají počty kopií ve vzorcích

54 příklad linie živočišných buněk byla podstoupena umlčení (silencing) genu pkg2 s linie transfekované a netransfekované (kalibrátor) byla izolována RNA, přepsana do cDNA a provedeno qPCR s primery a probou na gen pkg2 a GAPDH (referenční gen). Snížila se exprese genu pkg2 po umlčení? pkg2 Eff 86% cDNA kalibrator C T 22,48 cDNA silencing C T 22,3 GAPDH Eff 77% cDNA kalibrator C T 20,05 cDNA silencing C T 16,  CT 2 –(5,33-2,43) (1+0,86) 0,18 /(1+0,77) 3,08 pkg2 cDNA kalibrator 1,1x10 4 kopií cDNA silencing 1,23x10 4 kopií GAPDH cDNA kalibrator 1,55x10 4 kopií cDNA silencing 8,92x10 4 kopií 0,1340,1920,194 Gen snížil expresi 7,5x5,2x5,2x

55 navrhování primerů velikost amplikonu bp délka primerů20 bp primery se nesmí překrývat s próbou Tm 58-60◦C optimální teplota pro degradaci proby exonukleasovou aktivitou GC obsah 50-70% žádné vlásenky žádné dimery (self-dimery, cross-dimery)

56

57 navrhování proby délka proby13-25 bp primery se nesmí překrývat s próbou Tm 68-70◦C o 10◦C vyšší než Tm primerů GC obsah 50-70% žádné G na 5´konci zháší fluorescenci FAM barvy

58 navrhování primer ů a proby

59 kontaminace genomickou DNA 1) ošetření vzorků před RT DNasou 2) navržení primerů do dvou exonů mezi nimiž je dlouhý intron 3) navržení primeru nebo proby na přechod intron/exon

60 MGB PROBY minor groove binding stabilizuje vazbu proby na ssDNA výrazně zvyšuje Tm můžeme navrhovat krátké proby při zachování vysoké Tm

61

62 využití pro alelické diskriminace MGB PROBY

63 kolik replikací a kdy replikovat? sample extrakce RNA přepis do cDNA qPCR 6X 3X

64 kolik replikací a kdy replikovat? ideální 3x 27X sample extrakce RNA přepis do cDNA qPCR

65 instrumentace 7500 Real Time PCR System 7900HT Real Time PCR System StepONE Real Time PCR System

66 excitační filtry emisní filtry halogenová lampa zkumavky se vzorky v peltierovém bloku zesilovač ccd kamera

67 instrumentace

68

69 Využití REAL TIME PCR pro detekci jednobodové mutace (lékařská diagnostika)

70 HRM ANALYSA (HIGH RESOLUTION MELT) detekce SNP bez specifických sond díky kvalitní instrumentaci Corbett (  0.02◦C) a nové generaci interkalačních barviv (LCGreenPlus)

71 HRM ANALYSA pro amplikony do 200bp

72 Aplikace PCR a využití v praxi

73 DIAGNOSTIKA V MEDICÍNĚ detekce virových a bakteriálních onemocnění

74 Aplikace PCR a využití v praxi DIAGNOSTIKA V MEDICÍNĚ detekce geneticky vrozených chorob (mutace DNA) -AS PCR alelicky specifická PCR primer navržen tak, že mutace odpovídá konci primeru fragmenty DNA s nespárovanými konci se pohybují v elektrickém poli pomaleji -Real time PCR pomocí fluorescenční sondy odpovídající mutaci Např. detekce cystické fibrózy, choroba je podmíněná třínukleotidovou delecí v genu CFTR cystic fibrosis transmembrane regulator

75 Aplikace PCR a využití v praxi NEZÁVADNOST POTRAVIN

76 Aplikace PCR a využití v praxi KRIMINALISTIKA VNRT – variable number of tandem repeat – vyskytují se na různých lokusech chromozomů a v populací kolísají mezi jedinci v počtu opakování mezi 4-40x např. GTGTGTGT

77 Aplikace PCR a využití v praxi ANALÝZA POTRAVIN molekulárně-genetické zhodnocení surovin živočišného a rostlinného původu, které byly vyprodukovány klasickým pěstováním (chovem) nebo s použitím genového inženýrství průkaz falšování potravin druhovou záměnou (rostlinného i živočišného původu) identifikace mikroorganismů kontaminující potraviny nebo geneticky změněných mikroorganismů používaných jako startovací nebo ochranné kultury v produkci potravin. skotovceprasekozaTEST EVOLUČNÍ BIOLOGIE ORNITOLOGIE


Stáhnout ppt "TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce."

Podobné prezentace


Reklamy Google