Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Počítačová chemie (6. přednáška) Úvod ( 1. přednáška ) Molekula –Struktura molekuly (2., 3. a 4. přednáška) –Geometrie molekuly (5. přednáška) –Vhled do.

Podobné prezentace


Prezentace na téma: "Počítačová chemie (6. přednáška) Úvod ( 1. přednáška ) Molekula –Struktura molekuly (2., 3. a 4. přednáška) –Geometrie molekuly (5. přednáška) –Vhled do."— Transkript prezentace:

1 Počítačová chemie (6. přednáška) Úvod ( 1. přednáška ) Molekula –Struktura molekuly (2., 3. a 4. přednáška) –Geometrie molekuly (5. přednáška) –Vhled do praxe (6. přednáška) Molekulové modelování –Molekulová mechanika (7. a 8. přednáška) –Kvantová mechanika (9. a 10. přednáška) –Molekulová dynamika (11. přednáška) –Vhled do praxe (12. přednáška)

2 Vhled do praxe Struktura molekul Geometrie molekul Vyhledávání v chemických databázích

3 Struktura molekuly Ke grafickému znázornění struktury molekuly slouží její strukturní vzorec. Pro vytváření a vizualizaci strukturních vzorců molekuly lze využít: –klasické grafické programy –vektorové grafické programy –vektorové grafické programy, specializované na práci se strukturními vzorci: ChemWindow, ISIS, atd.

4 Struktura molekuly Demo: –Ukázka programů ChemWindow, ISIS –Předvedení nakreslení TNT –Úkol: nakreslete si LSD, uložte jako MOL soubor

5 Geometrie molekuly -fyzické modely Historicky nejstarším grafickým znázorněním geometrie molekuly byl fyzický model dané molekuly. = konstrukce v níž byly vazby a atomy znázorněny fyzickými objekty (například dráty a kuličkami) a uspořádány v prostoru stejně jako v rámci molekuly (v odpovídajícím měřítku).

6 Geometrie molekuly - fyzické modely - historie Historie fyzických modelů: 1958 Kendrew První fyzický model molekuly (myoglobin, měřítko 5 cm / Å, využit mosazný drát) Richards Optický srovnávač, který zjednodušil tvorbu Kendrewových modelů. konec 70-tých let Rubin & Richardson Stroj pro ohýbání drátu do tvaru, odpovídajícího uspořádání hlavního řetězce proteinu.

7 Geometrie molekuly - fyzické modely - historie II Poté, co se začaly v 60-tých letech používat k vizualizaci molekul počítače, přestaly být fyzické modely v chemii využívány. Bylo totiž velmi netriviální je vytvořit, byly drahé, zabíraly velký prostor a bylo náročné je modifikovat. V součastnosti se tyto modely využívají hlavně v následujících oblastech: –didaktika –umění

8 Geometrie molekuly - fyzické modely - historie III Molekulové sochařství: 1973 Rubinova molekulová socha ruberdoxinu: Další molekuloví sochaři: Meyer, Eward

9 Geometrie molekuly - počítačové znázornění Cílem je znázornit 3D strukturu ve 2D rovině => třetí rozměr je nutno nějakým způsobem simulovat: –stínování –možnost rotace molekuly –stereovize

10 Geometrie molekuly - počítačové znázornění - historie 1964 Levinthal Zobrazení rotujícího spojnicového modelu molekuly na obrazovce osciloskopu Richardsonovi Visualizace molekuly pouze pomocí počítače (bez fyzického modelu). Využili poznatky z rontgenové krystalografie Porter „Atlas struktur molekul“.

11 Geometrie molekuly - počítačové znázornění - historie II 1980 Merchant Metodika TAMS (Teaching Aids for Macromolecular Structure), zobrazující molekulu pomocí stereo slidů: = dvojice slidů: Na jednom je molekula v základní poloze. Na druhém v poloze pootočené o jistý úhel (kolem 4°). Tím je simulováno klasické prostorové vidění = každé oko zaznamenává obraz z jiného úhlu a mozek z nich vytváří plastický obraz. Pro sledování stereo slidů jsou nezbytné speciální brýle, které odstiňují vliv okolí.

12 Geometrie molekuly - počítačové znázornění - historie III 80-tá léta Evans a Sutherland Vektorové počítače E & S Computers pro zpracovávání krystalografických dat. Využívaly vizualizační programový balík FRODO Richardsonovi Programový balík CHAOS pro E & S Computers (efektivnější než FRODO) Richardsonovi Znázornění pohybu molekul pomocí kineimage (zkratka z kinetic image), neboli animace pohybu molekul. Pro práci s kineimages vytvořeny programy MAGE a PREKIN.

13 Geometrie molekuly - počítačové znázornění - historie III 1992 Sayle Program RasMol (zkratka ze slov Raster Molekule) - první vizualizační program, který se používal hromadněji (a používá se dodnes). Součastnost: Velké množství programů pro práci s geometrií molekuly.

14 Geometrie molekuly - modely molekuly I Drátový model (wire-frame):

15 Geometrie molekuly - modely molekuly II Tyčinkový model (sticks):

16 Geometrie molekuly - modely molekuly III Tyčinky a kuličky (ball & sticks):

17 Geometrie molekuly - modely molekuly V Kalotový model (CPK, spacefill): Vyvinut Coreyem a Paulingem a poté vylepšen Kultunem. Atomy znázorněny jako koule, jejichž velikosti odpovídá (v příslušném měřítku) poloměrům* daných atomů. * Konkrétně van der Waalsovským poloměrům. Vdw poloměr je 1/2 vzdálenosti mezi dvojicí volných (=není mezi nimi vazba) atomů v krystalu.

18 Geometrie molekuly - programy pro práci s geometrií Využití programů: –vizualizace geometrie molekuly –měření geometrických charakteristik molekuly: délka vazby, vzdálenost 2 atomů v molekule, vazebný úhel, dihedrální úhel, RMSD,... –vytváření geometrie molekuly

19 Geometrie molekuly - programy pro práci s geometrií II Konkrétní programy a jejich vlastnosti:

20 Geometrie molekuly - formáty souborů s molekulami Existuje velmi mnoho formátů pro zápis geometrie molekuly. Některé obsahují i informace o vazbách. Nejpoužívanější formáty: PDB (formát, používaný v databázi proteinů PDB) MOL (formát používaný v databázích organických látek) Další formáty: Alchemy, Ball and Stick, Boogie, Cambridge CADPAC, Chem3D Cartesian 1, CSD CSSR, CSD GSTAT, Free Form Fractional, Gaussian Z-Matrix, Hyperchem HIN, Mac Molecule, Micro World, MM2 Ouput, MMADS, MOLIN, Mopac Internal, PC Model, Quanta, Spartan, Spartan Mol, Sybyl Mol2, Maccs 2d, UniChem XYZ, XED, AMBER PREP, Biosym, Cacao Cartesian, CHARMm, Chem3D Cartesian 2, CSD FDAT, Feature, GAMESS Output, Gaussian Output, MDL Isis, Macromodel, MM2 Input, MM3, MDL MOLfile, Mopac Cartesian, Mopac Output, PDB, ShelX, Spartan Semi- Empirical, Sybyl Mol, Conjure, Maccs 3d, XYZ, Převod mezi formáty: BABEL, on-line demo:

21 Geometrie molekuly Demo: –Program Rasmol, molekula ala-pro-ala, ukázka modelů (drátový, tyčinkový, tyčinky & kuličky, kalotový). –Program VMD a ala-pro-ala. –Program Rasmol, molekula chlorhydroxyethenu, změřit délku vazby, vazebný úhel a torzní úhel. –Měření RMSD pomocí VMD (ala-pro-ala) –Program ChemSketch, vytvořit molekulu, ukázat 3D. –Uložit jako MDL, převod do PDB, ukázat 3D v Rasmolu.

22 Geometrie molekuly Demo - úkol: –! strukturní vzorec LSD –Vyzkoušejte si vizualizovat molekulu LSD pomocí Rasmolu a VMD, vyzkoušejte si různé modely. –Pomocí programu 3D Viewer změřte pro molekulu cis2butenu: Vzdálenost atomů 1 a 3; úhel atomů 1, 2 a 3; torzní úhel atomů 1, 2, 3 a 4. –Vytvořte si pomocí programu ChemScatch molekulu propanolu, optimalizujte si její 3D strukturu a podívejte se na ní pomocí programu 3D Viewer. –Uložte si tuto molekulu do MDL souboru, převeďte je (BABELem) do PDB souboru, podívejte se na něj v Rasmolu. –Navíc: RMSD pro 2 molekuly ala-pro-ala (podle souboru measure.txt)

23 Chemické databáze Typy databází: –databáze anorganických látek –databáze organických látek –databáze biomolekul proteiny nukleové kyseliny

24 Chemické databáze - databáze anorganických a organických molekul Obsahují nejčastěji následující informace: –1D data: bibliografické informace o molekule –2D data: struktura molekuly –3D data: geometrie molekuly –3D krystalografická data: způsob uspořádání molekuly v krystalu

25 Chemické databáze - databáze anorganických a organických molekul

26 Příklady databází: –Databáze anorganických krystalových struktur ICSD: –Cambridgská strukturní databáze organických molekul: Chemické databáze - databáze anorganických a organických molekul

27 Chemické databáze - databáze proteinů Protein = řetězec aminokyselin (existuje 20 základních aminokyselin):

28 Chemické databáze - databáze proteinů

29 Struktura proteinu: Primární: Popisuje jaké aminokyseliny tvoří protein. Sekundární: Popisuje jakým způsobem jsou aminokyseliny spojeny pomocí vodíkových vazeb. Existují dva základní způsoby uspořádání aminokyselin pomocí vodíkových vazeb: struktura skládaného listu a dvojité šroubovice. Terciální: Popisuje jak jsou řetězce aminokyselin organizovány v prostoru. Kvartérní: Popisuje jakými podjednotkami je tvořen protein.

30 Chemické databáze - databáze proteinů Struktura skládaného listu:

31 Chemické databáze - databáze proteinů Struktura beta-šroubovice:

32 Poznámka: Geometrie proteinů - modely molekuly I Drátový model: Tyčinkový model:

33 Poznámka: Geometrie proteinů - modely molekuly II Tyčinky a kuličky:Kalotový model:

34 Poznámka: Geometrie proteinů - speciální modely molekuly Páskový model (ribbons): Používá se pro proteiny a nukleové kyseliny. Znázorňuje hlavní řetězec (kostru) molekuly pomocí pásku, ležícího v rovině řetzce.

35 Poznámka: Geometrie proteinů - speciální modely molekuly II Schématický model (cartoon): Používá se pro proteiny. Znázorňuje hlavní řetězec (kostru) molekuly pomocí následujícího schématu: –Části hlavního řetězce, mající strukturu dvoušroubovice listu, jsou znázorněny páskem. – Části hlavního řetězce, mající strukturu skládaného listu, jsou znázorněny páskem, zakončeným šipkou. –Ostatní části hlavního řetězce jsou znázorněny tyčkou.

36 Chemické databáze - databáze proteinů Existují následující typy databází proteinů: Databáze primárních struktur: –Příklady: PIR, MIPS, SwissProt, TeEMBL, NRL-3D Komplexní databáze primárních struktur: –Spojují více primárních zdrojů, využívají specificku množinu vyhledávacích kritérií. (Například vyhledávání proteinů, obsahujících určitý strukturní vzor.) –Příklady: NRDB, OWL, MIPSX, SwisProt+TrEMBL

37 Chemické databáze - databáze proteinů Databáze sekundárních struktur: –Obsahují informace, odvozené z primárních sekvencí –Tyto informace jsou nejčastěji reprezentovány v abstraktní formě: regulární výrazy, bloky, speciální chemické struktury (např. fingerprints) –Příklady: PROSITE, PRINTS, BLOCKS, PROFILES, PFAM, IDENTITY Komplexní databáze sekundárních struktur: –Analogicky jako komplexní databáze primárních struktur. –Příklad: Interpro

38 Chemické databáze - databáze proteinů Databáze terciálních struktur (geometrií): –Obsahují prostorové souřadnice daného proteinu (nejčastěji ve formátu PDB) –Příklad: PDB (Protein Data Bank), PDBsum

39 Chemické databáze - databáze nukleových kyselin Nukleová kyselina - schéma:

40 Chemické databáze - databáze nukleových kyselin Nukleosid - základní jednotka nukleové kyseliny:

41 Chemické databáze - databáze nukleových kyselin Báze DNA: Cukr DNA - deoxyribosa: Báze RNA (místo T): Cukr RNA - ribosa:

42 Poznámka: Geometrie nukleových kyselin - modely molekuly I Drátový model: Tyčinkový model:

43 Poznámka: Geometrie nukleových kyselin - modely molekuly II Tyčinky a kuličky:Kalotový model:Páskový model:

44 Chemické databáze - databáze nukleových kyselin Existují následující typy databází nukleových kyselin: Databáze primárních struktur: –Příklady: EMBL, DDBJ, GenBank, dbEST Speciální DNA databáze: –Obsahují druhově specifické DNA, nebo DNA, získané pouze určitým postupem –Příklady: SGD, UniGene, TDB, ACeDB

45 Chemické databáze - úkoly Pomocí programu Rasmol si vizualizujte molekulu DNA a hemoglobinu a vyzkoušejte si použití různých modelů molekuly. V databázi anorganických látek najděte informace o minerálu apatitu (anglicky apatite :-) V databázi PIR najděte informace o proteinu albuminu. V databázi PDB najděte informace o jedu mamby zelené (jed = venom :-). Stáhněte si soubor s geometrií proteinu (PDB soubor), tvořícího daný jed a prohlédněte si ho v nějakém vizualizačním programu. V databázi DDBJ najděte libovolnou DNA začínající bazemi: CACCCTCTCTTCACTGGAAA a prohlédněte si její primární strukturu


Stáhnout ppt "Počítačová chemie (6. přednáška) Úvod ( 1. přednáška ) Molekula –Struktura molekuly (2., 3. a 4. přednáška) –Geometrie molekuly (5. přednáška) –Vhled do."

Podobné prezentace


Reklamy Google