Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Analýza mutace C282Y v genu pro hemochromatózu. PCR – mutace C282Y (hemochromatóza) MASTER MIX – na 1 vzorek 15,8 ul H 2 O 2,5 ul pufr 1,5 ul primer 1.

Podobné prezentace


Prezentace na téma: "Analýza mutace C282Y v genu pro hemochromatózu. PCR – mutace C282Y (hemochromatóza) MASTER MIX – na 1 vzorek 15,8 ul H 2 O 2,5 ul pufr 1,5 ul primer 1."— Transkript prezentace:

1 Analýza mutace C282Y v genu pro hemochromatózu

2 PCR – mutace C282Y (hemochromatóza) MASTER MIX – na 1 vzorek 15,8 ul H 2 O 2,5 ul pufr 1,5 ul primer 1 (P1) 1,5 ul primer 2 (P2) 2,0 ul MgCl 2 0,5 ul dNTP 1,0 ul DNA 0,2 ul Taq polymeráza (přidat na ledu)

3 PCR – mutace C282Y - ELFO

4 RFLP –polymorfizmus délky restrikčních fragmentů restrikční analýza DNA pomocí jejího štěpení restrikčními endonukleázami (RE) ve specifických restrikčních místech pokud sekvenční diference (polymorfizmus) vytváří nebo ruší specifické místo pro RE, vznikají po restrikci fragmenty odlišných velikostí

5 RFLP –polymorfizmus délky restrikčních fragmentů restrikční analýza DNA pomocí jejího štěpení restrikčními endonukleázami (RE) ve specifických restrikčních místech pokud sekvenční diference (polymorfizmus) vytváří nebo ruší specifické místo pro RE, vznikají po restrikci fragmenty odlišných velikostí

6 RFLP –polymorfizmus délky restrikčních fragmentů Restrikční endonukleázy (RE) –známo asi 2100 bakteriálních RE –RE rozpoznávají různě krátké sekvence nukleotidů (4,6,8),ve kterých pak štěpí kovalentní fosfodiesterové vazby Princip analýzy –výchozí DNA (genomická DNA, PCR produkt) –štěpení restrikčním enzymem na fragmenty různých velikostí –elektroforetická separace fragmentů

7 Sekvence oblasti mutace C282Y 5´- TGGCAAGGGTAAACAGATCCctctcctcatccttcctctttcctgtcaagtgccctcctttggtgaaggtgacacatcatgtgacctcttca g tgaccac a ctacggtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagccaatggatgccaaggagttcgaac c taaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctGTACcccctggggaagagcagagatatacGT G Ccaggtgg a gcacccaggcctggatcagcccctcattgtgatctggggtatgtgactgatgagagccaggagctgagaaaatctattgggGGTTGAGAGGA G TGC CTGAGgaggtaattatggcagtgagatgaggatctgctctttgttagggggtgggctgagggtggcaatcaaaggctttaacttgctttttctgttttagagccctca ccgtctggcaccctagtcattggagtcatcagtgga – 3´ Primery místo GTAC štěpí restrikční endonukleáza RsaI místo mutace C282Y změna GTGC na GTAC

8 RFLP – mutace C282Y MASTER MIX – na 1 vzorek 7,0 ul H 2 O 2,0 ul pufr 10 ul PCR produkt 1,0 restrikční endonukleáza RsaI (přidat na ledu) Inkubovat 37°C 2 hod

9

10 RFLP – mutace C282Y - ELFO

11 HEMOCHROMATÓZA hereditární hemochromatóza - relativně časté dědičné onemocnění charakterizované vstřebáváním nadbytku železa, jeho ukládáním v orgánech a z toho pak rezultujícím poškozením organismu hepatopatie, diabetes mellitus, arthropatie, impotence, amenorhea, kardiomyopatie, endokrinní poruchy sérové železo, saturace transferinu, sérový ferritin, jaterní biopsie venepunkční terapie, desferrioxamin

12 Mutace HFE genu


Stáhnout ppt "Analýza mutace C282Y v genu pro hemochromatózu. PCR – mutace C282Y (hemochromatóza) MASTER MIX – na 1 vzorek 15,8 ul H 2 O 2,5 ul pufr 1,5 ul primer 1."

Podobné prezentace


Reklamy Google