Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Cystická fibróza Autosomálně recesivní onemocnění (postiženi jsou homozygoti, heterozygoti jsou přenašeči) Frekvence přenašečů - etnická variabilita, 1.

Podobné prezentace


Prezentace na téma: "Cystická fibróza Autosomálně recesivní onemocnění (postiženi jsou homozygoti, heterozygoti jsou přenašeči) Frekvence přenašečů - etnická variabilita, 1."— Transkript prezentace:

1 Cystická fibróza Autosomálně recesivní onemocnění (postiženi jsou homozygoti, heterozygoti jsou přenašeči) Frekvence přenašečů - etnická variabilita, 1 z 25 u jedinců severoevropského původu, postihuje obě pohlaví rovnoměrně CFTR – gen pro cystic fibrosis transmembrane conductance regulator, lokalizován na 7 chromosomu Mutace v genu CFTR CFTR kóduje chloridový kanál, zodpovědný za transport chloridových iontů přes plasmatickou membránu epiteliáních buněk, které tvoří výstelku dýchacích cest, pankreatu a dalších tkání Porucha iontového transportu

2 Onemocnění závažná a chronicky progredující choroba porušená funkce CFTR vede k poškození plic (progresivní destrukce plic) –v důsledku hromadění viskózního hlenu v plicích – obstrukce, opakované, chronické infekce (pneumonie, Pseudomonas, Cephacia), sekundární zánětlivý proces -poškození plic zkracuje životnost na let postižení trávicího traktu -pankreatická sekrece - problémy s trávením (pankreatická insuficience - tuková a proteinová malabsorpce), porucha vylučovaní enzymů vedoucí k fibróze -játra - jaterní léze, fokální biliární cirhóza -střevní obstrukce, meconiový ileus – (15-20% novorozenců) postižení reprodukčního traktu - narušené formování vas deferens - sterilita zpětná resorpce solí v potních žlázách, zvýšený obsah soli v potu, nadbytečné ztráty solí, důsledek nefunkčního CFTR potních žláz

3 Příčinacystickéfibrosy Příčina cystické fibrosy NBD -nucleotid vázající domény (ATP) R NBD1 NBD2 TM1 TM2 Cl - cAMP regulovaný chloridový kanál transport Cl - přes plasmatickou membránu epiteliáních buněk (dýchací cesty, pankreas, další orgány) mutace v genu CFTR R -regulační doména (cAMPdep.) TM - transmembránové domény lumen cytoplasma CFTR protein - cystic fibrosis transmembrane conductance regulator

4 Mutace delta F508 –nejčastější alela (70% CF) Δ F508 alela má 3 nukleotidovou deleci –delece aminokyseliny fenylalanin (F) v pozici 508 na aminokyselinové sekvenci chloridového transportéru 12 dalších častých mutací s frekvencí ~15% (celkem 1967 mutací Kit pro reverzní hybridizaci (34 mutací) – záchyt pro českou populaci ~91% CFTR mutace

5

6 MutaceCFTRgenu Mutace CFTR genu mutace jsou germinální (ve všech buňkách jedince) somatické nebyly dosud popsány ancestrální povaha mutací - přenášeny z generace na generaci mutace de novo – velmi vzácně distribuce mutací je populačně specifická

7 Hemochromatóza autosomálně recesivní onemocnění, frekvence heterozygotů C282Y v ČR 1:15, neúplná penetrance hereditární hemochromatóza - relativně časté dědičné onemocnění charakterizované vstřebáváním nadbytku železa, jeho ukládáním v orgánech a z toho pak rezultujícím poškozením organismu hepatopatie, diabetes mellitus, arthropatie, impotence, amenorhea, kardiomyopatie, endokrinní poruchy sérové železo, saturace transferinu, sérový ferritin, jaterní biopsie venepunkční terapie, desferrioxamin

8 Mutace HFE genu

9 RFLP polymorfizmus délky restrikčních fragmentů restrikční analýza DNA pomocí jejího štěpení restrikčními endonukleázami (RE) ve specifických restrikčních místech pokud sekvenční diference (polymorfizmus) vytváří nebo ruší specifické místo pro RE, vznikají po restrikci fragmenty odlišných velikostí

10 RFLP polymorfizmus délky restrikčních fragmentů Restrikční endonukleázy (RE) –známo asi 2100 bakteriálních RE –RE rozpoznávají různě krátké sekvence nukleotidů (4,6,8),ve kterých pak štěpí kovalentní fosfodiesterové vazby Princip analýzy –výchozí DNA (genomická DNA, PCR produkt) –štěpení restrikčním enzymem na fragmenty různých velikostí –elektroforetická separace fragmentů

11 Analýza mutace C282Y v genu pro hemochromatózu

12 Sekvence oblasti mutace C282Y 5´- TGGCAAGGGTAAACAGATCCctctcctcatccttcctctttcctgtcaagtgccctcctttggtgaaggtgacacatcatgtgacctcttca g tgaccac a ctacggtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagccaatggatgccaaggagttcgaac c taaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctGTACcccctggggaagagcagagatatacGT G Ccaggtgg a gcacccaggcctggatcagcccctcattgtgatctggggtatgtgactgatgagagccaggagctgagaaaatctattgggGGTTGAGAGGA G TGC CTGAGgaggtaattatggcagtgagatgaggatctgctctttgttagggggtgggctgagggtggcaatcaaaggctttaacttgctttttctgttttagagccctca ccgtctggcaccctagtcattggagtcatcagtgga – 3´ Primery místo GTAC štěpí restrikční endonukleáza RsaI místo mutace C282Y změna GTGC na GTAC

13

14 RFLP – mutace C282Y - ELFO

15 RFLP – mutace C282Y+H63D (hemochromatóza) MASTER MIX – na 1 vzorek 17 ul H 2 O 2 ul pufr 10 ul PCR produkt 1 ul restrikční endonukleáza (přidat na ledu) C282Y: restrikční endonukleáza RsaI H63D: restrikční endonukleáza BclI

16 Mutace C282Y (v bp) Zdravý jedinec: Homozygotní stav: Heterozygotní stav: Vyhodnocení gelové elektroforézy po restrikční analýze

17 Mutace H63D (v bp) Nenaštěpená DNA:208 Zdravý jedinec:13870 Homozygotní stav:208 Heterozygotní stav: Vyhodnocení gelové elektroforézy po restrikční analýze

18 Analýza mutace delta F508 v CFTR genu Obecný primer (O) Specifický primer bez mutace (N) Specifický primer nesoucí mutaci (M) M O Cílová sekvence N ASO-PCR:

19 PCR reakce probíhá ve dvou zkumavkách: PCR Mix 0 obsahuje primer obecný a „normální“ (N) PCR Mix 1 obsahuje primer obecný a „mutovaný“ (M) O/N O/M Homozygo t bez mutace Heterozygo t přenašeč Homozygo t s mutací

20 ASO-PCR – mutace delF508 (cystická fibróza) PCR mix 1 voda8,5 µl pufr2,0 µl dNTP mix4,0 µl MgCl 2 2,0 µl primery M11,2 µl DNA2,0 µl Taq polymeráza0,4 µl (na ledu) PCR mix 0 voda8,5 µl pufr2,0 µl dNTP mix4,0 µl MgCl 2 2,0 µl primery M01,2 µl DNA2,0 µl Taq polymeráza0,4 µl (na ledu) PCR MASTER MIX – pro 1 vzorek

21 Alelově specifická PCR + gelová elektroforéza M0 – PCR reakce detekuje alelu bez dané mutace M1 – PCR reakce detekuje alelu s mutací Vyhodnocení výsledků analýzy CFTR genu Detekce mutace ΔF508 podmiňující cystickou fibrózu PCR produkt pro CFTR gen (ΔF508) PCR produkt pro kontrolní gen Nespotřebované PCR chemikálie (nemusí být vždy viditelné) M0 M1 zdravý homozygothomozygot s mutacíheterozygot


Stáhnout ppt "Cystická fibróza Autosomálně recesivní onemocnění (postiženi jsou homozygoti, heterozygoti jsou přenašeči) Frekvence přenašečů - etnická variabilita, 1."

Podobné prezentace


Reklamy Google