Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Sekvenace hybridizací současná metoda sekvenace. Sekvenace hybridizací současná metoda sekvenace.

Podobné prezentace


Prezentace na téma: "Sekvenace hybridizací současná metoda sekvenace. Sekvenace hybridizací současná metoda sekvenace."— Transkript prezentace:

1 Sekvenace hybridizací současná metoda sekvenace

2 Sekvenace hybridizací současná metoda sekvenace

3 Sekvenace se dělá ve dvou fázích Za použití DNA polymerázy a směsi normálních a modifikovaných deoxyribonukleotidů se syntetizuje vlákno DNA Produkty polymerizace se v automatických strojích chromatograficky dělí podle velikosti a vypovídají o sekvenci Jedna reakce podá informaci o bazích Sekvenace hybridizací současná metoda sekvenace

4 Sekvenace hybridizací současná metoda sekvenace

5 Sekvenace hybridizací současná metoda sekvenace

6 Sekvenace hybridizací ACGATGCATA CGTGATCGACGATGCATACGATGCAGTCGATGCGCATGC

7 Sekvenace hybridizací ACGTGGCTA ACGT CGTG GTGG TGGC GGCT GCTA ? TCTA CATG TGTC ACAT ATGT GTCT

8 Sekvenace hybridizací ACATGTCTA TCTA CATG TGTC ACAT ATGT GTCT

9 Sekvenace hybridizací ? CGT ACG GAC TCG GCG CGG GTC CGC GGA

10 Sekvenace hybridizací ACGTCGCGGAC ACG CGT GTC TCG CGC GCG CGG GGA GAC

11 Sekvenace hybridizací A ACAC CA TA TT CT CGCG GCGC ACACGCAACTTAAA ACAAACGCACTTAA ACA CAA AAA AAC ACG CGC GCA CAC ACT CTT TTA TAA

12 Sekvenace hybridizací SBH – Sequencing by hybridization SBH – 1988 Bains and Smith, Lysov et al. SBH – 1989 Dramanac et al., Pevzner PSBH – Positional SBH SBH s univerzálními bázemi Interaktivní SBH Resekvenace SBH s nepřesnostmi

13 Sekvenace hybridizací Univerzální báze 1. kombinace nukleotidů 2. sloučeniny na bázi inosinu, 5-nitroindol Preparata et al.: XXXX***X***X***X Použití mezer zvyšuje teoretickou sekvenovatelnost z délky 2**k téměř 4**k

14 Sekvenace hybridizací

15

16 Chyby znižují efektivnost už i tak poměrně nejisté procedury, pokud uvažujeme s možností chyb, musíme vyšetřit větší množstvo alternativních cest grafem oligonukleotidů Pevzner vyzkoušel SBH na 100 reálných sekvencích o délce 200. Při k=8 (65536 oligonukleotidů) úspěšně osekvenoval jenom 94 vzorků (potřeba oligonukleotidů na osekvenování sekvence délky n klasickou metodou je přibližně n**2)


Stáhnout ppt "Sekvenace hybridizací současná metoda sekvenace. Sekvenace hybridizací současná metoda sekvenace."

Podobné prezentace


Reklamy Google