Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

DNA obecně. Sejmutí DNA K analýze získaných vzorků biologického materiálu, který mohou představovat krev, spermie, sliny, nosní hlen, vlasy, kosti, moč,

Podobné prezentace


Prezentace na téma: "DNA obecně. Sejmutí DNA K analýze získaných vzorků biologického materiálu, který mohou představovat krev, spermie, sliny, nosní hlen, vlasy, kosti, moč,"— Transkript prezentace:

1 DNA obecně

2 Sejmutí DNA K analýze získaných vzorků biologického materiálu, který mohou představovat krev, spermie, sliny, nosní hlen, vlasy, kosti, moč, částečky kůže či jiných tkání

3 Sejmutí DNA Aktuálně je běžným způsobem získávání takového materiálu tzv. bukální stěr, což je nenáročná a bezbolestná metoda. Spočívá ve stěru buněk z ústní dutiny - zkoumaná osoba si jednoduše přejede sterilním tamponem na dřevěné tyčce po vnitřní straně úst. V praxi jsou používány předem připravené tampony na dřevěné násadce, které jsou distribuovány se skleněným pouzdrem, jakousi zkumavkou, v níž jsou pak zasílány k laboratornímu zpracování. Metoda analýzy DNA je velmi spolehlivá a univerzální.

4 Hrdinové Laboratoří Pro studium DNA má smysl se zaměřit na několik málo organismů a z jejich studia činit obecně platné závěry. Vybrané organismy musí být snadno a levně chovatelné v laboratorních podmínkách. Genetici potřebují, aby se jimi zkoumaní tvorové rychle množili a měli početné potomstvo, aby mohli sledovat osud genů napříč generacemi. Používají se především myši (viz další slajd), Žáby drápatky (kvůli vajíčkům), octomilky, Caenorhabditis elegans – červ (nemá české jméno) – žádný jiný mnohobuněčný druh takto podrobně zmapovaný nemáme

5 Hrdinové Laboratoří - Myši Myš domácí. Z modelových organismů je člověku nejbližší, každý stý myší gen nemá svou obdobu v buňkách člověka. Po člověku byla druhým savcem, jehož úplná genetická informace byla písmenko po písmenku přečtena. Genetici ji klonují, vnášejí do ní cizí geny, nebo naopak její vlastní geny "vypínají", testují na ní nové léky, poznávají fungování buněk... Knockoutování genů: Je to složitá, ale také užitečná metoda, kterou lze v myším těle "vypnout" jeden pečlivě vybraný gen. Podle toho, jak tzv. knockoutovaná myš vypadá nebo jak se chová, lze usuzovat na funkci, kterou gen v těle plní

6 Člověk,Šimpanz, Mrkev Porovnáme-li genetický materiál u lidí a u šimpanzů, skutečně zjistíme, že se téměř 99 z každých 100 porovnatelných míst shoduje. Tento postup však opomíjí většinu toho, co jsme za poslední čtvrtstoletí o evoluci genomu zjistili. Mutační procesy jsou mnohem složitější, než se před několika desítkami let myslelo, neboť mezi blízce příbuznými genomy prostřednictvím sklouznutí, duplikace, transpozice a nepatřičné rekombinace řetězců vznikají kvalitativní rozdíly. např: Geny, které vedou ke vzniku lidské a šimpanzí stehenní kosti mohou být sice z 98-99% totožné, ale přesto nemůžeme říct, zda samotné kosti jsou si více či méně podobné. Na druhou stranu jsou lidé schopni brát od šimpanzů transfůzi a naopak. Platí že veškerý mnohobuněčný život, který se pravděpodobně vyvinul z jediné společné prapůvodní podoby, musí být co do sekvencí DNA totožný z více než 25%. Jinými slovy, člověk a mrkev musí mít geneticky mnoho společného, navzdory jejich značné fyzické nepodobnosti. Tady komparace DNA silně přeceňuje skutečné vztahy mezi druhy. Genetická srovnání zkrátka neposkytují „vnitřní pohled“ na vztahy mezi druhy ani souhrn těchto vztahů.

7 Jak buňka funguje Veškeré informace (programy) pro stavbu a fungování buňky jsou uloženy v molekule desoxyribonukleové kyseliny -- DNA -- v pořadí jejich stavebních jednotek -- nukleotidů. Čtyři různé nukleotidy (Adenin, Guanin, Cytosin a Thymin) jsou vázány chemickou vazbou v lineární řetězec, jejich pořadí přitom může být zcela libovolné. Abeceda buněčných programů je tedy čtyřpísmenná. Jednotlivé nukleotidy jsou spojeny vodíkovými můstky, mohou se spojovat jen nukleotidy A-C a G-T.

8 Jak buňka funguje Standardní DNA řetězec může vypadat takhle: ATGCTCGAATAAATGTCAATTTGA Tento řetězec dále rozdělíme na slova (triplety) ATG CTC GAA TAA ATG TCA ATT TGA Výsledkem jsou sekvence zvané Geny Geny jsou instrukční manuál pro tvorbu všech bílkovin v našem těle. Jsou zodpovědny za tvorbu jednotlivých částí našeho těla.

9 Jak buňka funguje Každý gen začíná šifrou, jež jej jednoznačně identifikuje, dále pokračuje daty. Šifru a data jednotlivých genů jsou schopny číst enzymy, které dále přepisují geny do jednotlivých RNA (viz níže) Před začátkem genu je kromě místa, kam nasedá ``čtecí enzym'', též místo, na které mohou nasedat regulační bílkovinné molekuly -- aktivátory nebo represory. Ty svou přítomností buď usnadňují nebo znemožňují nasednutí ``čtecího enzymu'' na začátek genu, a tak vlastně určují, jak často (nebo zda vůbec) bude daný gen (program) čten, a následně zdali (a jak moc) se bude vyrábět bílkovina v tomto genu zapsaná

10 Jak buňka funguje GENOM: Soubor všech genů v 1 buňce jeden genom obsahuje kolem 3 miliard písmen, lidé jsou odlišní v 0,1% párů. To znamená asi ve třech milionech párů. Jeden gen obsahuje zhruba 1000 párů => Každý tří miliontý člověk by měl mít stejnou DNA (vyjimku tvoří jednovaječná dvojčata). Dále během života dojde asi ke 30ti mutacím různých genů, jež většinou negativně ovlivňují zdraví člověka. Jednotlivé spirály DNA měří zhruba 3m a jsou uloženy v několika chromosomech nacházejících se uvnitř jádra buňky.

11 Jak buňka funguje

12 Všechny lidské buňky obsahují 46 chromosomů. DNA je uložena ve dvou sadách po 23. chromosomech.

13 Jak buňka funguje Jak se podle programu v DNA (genu) vyrobí bílkovina? Není-li represorem zabráněno čtení genu, může ``čtecí enzym'' -- RNA- polymeráza -- nasednout na šifru označující začátek genu. Poté se ``rozjede'' po vlákně DNA (přičemž v místě, kde nasedá, odstrkuje párující řetězec) a ke každému nukleotidu čteného vlákna přiřadí párující (``negativní'') nukleotid. (V buňce je trvale určitá koncentrace volných nukleotidů.) Vzhledem k tomu, že nukleotidy, z nichž je stavěn nový řetězec, se nepatrně (o 1 atom kyslíku) liší od nukleotidů DNA, označuje se jejich řetězec jako kyselina ribonukleová -- RNA. Molekula RNA, na které je přepsán právě jeden gen z DNA, je m-RNA Pokud bychom připodobnili DNA, kde je veškerá informace buňky, k centrální knihovně nebo archivu v továrně na bílkoviny, byly by pak molekuly m-RNA výrobními výkresy jednotlivých bílkovin, které byly okopírovány podle originálů v knihovně, aby mohly být odneseny do dílny, kde se podle nich vyrobí bílkovina.

14 Jak buňka funguje

15 ``Výrobními stroji'' na bílkoviny jsou v buňce ribosomy -- částice složené z několika molekul bílkovin a r-RNA. Ribosomy nasedají na molekulu m-RNA a ``čtou'' ji.. Rozdíl spočívá v tom, že stavebními částicemi nově vznikajícího řetězce nejsou nukleotidy, ale aminokyseliny -- stavební kameny bílkovin. Každá aminokyselina je přitom specificky přiřazena ke třem za sebou následujícím nukleotidům (tripletům) v řetězci m-RNA. Znamená to, že počet aminokyselin ve vznikajícím řetězci bílkoviny bude třetinový vzhledem k počtu nukleotidů v molekule m-RNA Na ribosomech tedy probíhá překlad čtyřpísmenného zápisu v m- RNA (A, T, C, G) do dvacetipísmenné řeči bílkovin -- v bílkovinách se vyskytuje 20 různých aminokyselin (některé aminokyseliny jsou kódovány více než jedinou trojicí nukleotidů ).

16 Jak buňka funguje

17 Konec

18 Zdroje


Stáhnout ppt "DNA obecně. Sejmutí DNA K analýze získaných vzorků biologického materiálu, který mohou představovat krev, spermie, sliny, nosní hlen, vlasy, kosti, moč,"

Podobné prezentace


Reklamy Google