Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Vhled do praxe I Kdy: 29.10. 2003 –1. skupina (příjmení A - M): 16:00 - 17:40 –2. skupina (příjmení N - Z): 18:00 - 19:40 Kde: –Přírodovědecká fakulta,

Podobné prezentace


Prezentace na téma: "Vhled do praxe I Kdy: 29.10. 2003 –1. skupina (příjmení A - M): 16:00 - 17:40 –2. skupina (příjmení N - Z): 18:00 - 19:40 Kde: –Přírodovědecká fakulta,"— Transkript prezentace:

1 Vhled do praxe I Kdy: –1. skupina (příjmení A - M): 16: :40 –2. skupina (příjmení N - Z): 18: :40 Kde: –Přírodovědecká fakulta, Kotlářská 2 –Učebna COMPC (budova děkanátu, přízemí, vlevo )

2

3 Počítačová chemie (6. přednáška) Úvod ( 1. přednáška ) Molekula –Struktura molekuly (2., 3. a 4. přednáška) –Geometrie molekuly (5. přednáška) –Vhled do praxe (6. přednáška) Molekulové modelování –Molekulová mechanika (7. a 8. přednáška) –Kvantová mechanika (9. a 10. přednáška) –Molekulová dynamika (11. přednáška) –Vhled do praxe (12. přednáška)

4 Vhled do praxe Struktura molekul Geometrie molekul Vyhledávání v chemických databázích

5 Struktura molekuly Ke grafickému znázornění struktury molekuly slouží její strukturní vzorec. Pro vytváření a vizualizaci strukturních vzorců molekuly lze využít: –klasické grafické programy –vektorové grafické programy –vektorové grafické programy, specializované na práci se strukturními vzorci: ChemWindow, ISIS, atd.

6 Struktura molekuly Demo: –Ukázka programů ChemWindow & ISIS –Předvedení nakreslení TNT –Úkol: nakreslete si LSD:

7 Geometrie molekuly -fyzické modely Historicky nejstarším grafickým znázorněním geometrie molekuly byl fyzický model dané molekuly. = konstrukce v níž byly vazby a atomy znázorněny fyzickými objekty (například dráty a kuličkami) a uspořádány v prostoru stejně jako v rámci molekuly (v odpovídajícím měřítku).

8 Geometrie molekuly - fyzické modely - historie Historie fyzických modelů: 1958 Kendrew První fyzický model molekuly (myoglobin, měřítko 5 cm / Å, využit mosazný drát) Richards Optický srovnávač, který zjednodušil tvorbu Kendrewových modelů. konec 70-tých let Rubin & Richardson Stroj pro ohýbání drátu do tvaru, odpovídajícího uspořádání hlavního řetězce proteinu.

9 Geometrie molekuly - fyzické modely - historie II Poté, co se začaly v 60-tých letech používat k vizualizaci molekul počítače, přestaly být fyzické modely v chemii využívány. Bylo totiž velmi netriviální je vytvořit, byly drahé, zabíraly velký prostor a bylo náročné je modifikovat. V součastnosti se tyto modely využívají hlavně v následujících oblastech: –didaktika –umění

10 Geometrie molekuly - fyzické modely - historie III Molekulové sochařství: 1973 Rubinova molekulová socha ruberdoxinu: Další molekuloví sochaři: Meyer, Eward

11 Geometrie molekuly - počítačové znázornění Cílem je znázornit 3D strukturu ve 2D rovině => třetí rozměr je nutno nějakým způsobem simulovat: –stínování –možnost rotace molekuly –stereovize

12 Geometrie molekuly - počítačové znázornění - historie 1964 Levinthal Zobrazení rotujícího spojnicového modelu molekuly na obrazovce osciloskopu Richardsonovi Visualizace molekuly pouze pomocí počítače (bez fyzického modelu). Využili poznatky z rontgenové krystalografie Porter „Atlas struktur molekul“.

13 Geometrie molekuly - počítačové znázornění - historie II 1980 Merchant Metodika TAMS (Teaching Aids for Macromolecular Structure), zobrazující molekulu pomocí stereo slidů: = dvojice slidů: Na jednom je molekula v základní poloze. Na druhém v poloze pootočené o jistý úhel (kolem 4°). Tím je simulováno klasické prostorové vidění = každé oko zaznamenává obraz z jiného úhlu a mozek z nich vytváří plastický obraz. Pro sledování stereo slidů jsou nezbytné speciální brýle, které odstiňují vliv okolí.

14 Geometrie molekuly - počítačové znázornění - historie III 80-tá léta Evans a Sutherland Vektorové počítače E & S Computers pro zpracovávání krystalografických dat. Využívaly vizualizační programový balík FRODO Richardsonovi Programový balík CHAOS pro E & S Computers (efektivnější než FRODO) Richardsonovi Znázornění pohybu molekul pomocí kineimage (zkratka z kinetic image), neboli animace pohybu molekul. Pro práci s kineimages vytvořeny programy MAGE a PREKIN.

15 Geometrie molekuly - počítačové znázornění - historie III 1992 Sayle Program RasMol (zkratka ze slov Raster Molekule) - první vizualizační program, který se používal hromadněji (a používá se dodnes). Součastnost: Velké množství programů pro práci s geometrií molekuly.

16 Geometrie molekuly - modely molekuly I Drátový model (wire-frame):

17 Geometrie molekuly - modely molekuly II Tyčinkový model (sticks):

18 Geometrie molekuly - modely molekuly III Tyčinky a kuličky (ball & sticks):

19 Geometrie molekuly - modely molekuly V Kalotový model (CPK, spacefill): Vyvinut Coreyem a Paulingem a poté vylepšen Kultunem. Atomy znázorněny jako koule, jejichž velikosti odpovídá (v příslušném měřítku) poloměrům* daných atomů. * Konkrétně van der Waalsovským poloměrům. Vdw poloměr je 1/2 vzdálenosti mezi dvojicí volných (=není mezi nimi vazba) atomů v krystalu.

20 Geometrie molekuly - programy pro práci s geometrií Využití programů: –vizualizace geometrie molekuly –měření geometrických charakteristik molekuly: délka vazby, vzdálenost 2 atomů v molekule, vazebný úhel, dihedrální úhel, RMSD,... –vytváření geometrie molekuly

21 Geometrie molekuly - programy pro práci s geometrií II Konkrétní programy a jejich vlastnosti:

22 Geometrie molekuly Demo: –Stereo slidy pomocí DeepView pro crambin (protein ze semen brukve zelné). –Program Rasmol, molekula ala-pro-ala, ukázka modelů (drátový, tyčinkový, tyčinky & kuličky, kalotový). –Program VMD a ala-pro-ala. –Program 3D Viewer, molekula 2-hydroxyethanu, změřit délku vazby, vazebný úhel a torzní úhel. –Program ChemSketch, vytvořit molekulu, ukázat 3D. –Program eChem, totéž.

23 Geometrie molekuly Demo - úkol: –! strukturní vzorec LSD –Vyzkoušejte si vizualizovat molekulu LSD pomocí Rasmolu a VMD, vyzkoušejte si různé modely. –Pomocí programu 3D Viewer změřte pro molekulu cis2butenu: Vzdálenost atomů 1 a 3; úhel atomů 1, 2 a 3; torzní úhel atomů 1, 2, 3 a 4. –Vytvořte si pomocí programu ChemScatch molekulu propanolu, optimalizujte si její 3D strukturu a podívejte se na ní pomocí programu 3D Viewer. –Vytvořte tutéž molekulu pomocí programu eChem.

24 Chemické databáze Typy databází: –databáze anorganických látek –databáze organických látek –databáze biomolekul proteiny nukleové kyseliny

25 Chemické databáze - databáze anorganických a organických molekul Obsahují nejčastěji následující informace: –1D data: bibliografické informace o molekule –2D data: struktura molekuly –3D data: geometrie molekuly –3D krystalografická data: způsob uspořádání molekuly v krystalu

26 Chemické databáze - databáze anorganických a organických molekul

27 Příklady databází: –Databáze anorganických krystalových struktur ICSD: –Cambridgská strukturní databáze organických molekul: Chemické databáze - databáze anorganických a organických molekul

28 Chemické databáze - databáze proteinů Protein = řetězec aminokyselin (existuje 20 základních aminokyselin):

29 Chemické databáze - databáze proteinů

30 Struktura proteinu: Primární: Popisuje jaké aminokyseliny tvoří protein. Sekundární: Popisuje jakým způsobem jsou aminokyseliny spojeny pomocí vodíkových vazeb. Existují dva základní způsoby uspořádání aminokyselin pomocí vodíkových vazeb: struktura skládaného listu a dvojité šroubovice. Terciální: Popisuje jak jsou řetězce aminokyselin organizovány v prostoru. Kvartérní: Popisuje jakými podjednotkami je tvořen protein.

31 Chemické databáze - databáze proteinů Struktura skládaného listu:

32 Chemické databáze - databáze proteinů Struktura beta-šroubovice:

33 Poznámka: Geometrie proteinů - modely molekuly I Drátový model: Tyčinkový model:

34 Poznámka: Geometrie proteinů - modely molekuly II Tyčinky a kuličky:Kalotový model:

35 Poznámka: Geometrie proteinů - speciální modely molekuly Páskový model (ribbons): Používá se pro proteiny a nukleové kyseliny. Znázorňuje hlavní řetězec (kostru) molekuly pomocí pásku, ležícího v rovině řetzce.

36 Poznámka: Geometrie proteinů - speciální modely molekuly II Schématický model (cartoon): Používá se pro proteiny. Znázorňuje hlavní řetězec (kostru) molekuly pomocí následujícího schématu: –Části hlavního řetězce, mající strukturu dvoušroubovice listu, jsou znázorněny páskem. – Části hlavního řetězce, mající strukturu skládaného listu, jsou znázorněny páskem, zakončeným šipkou. –Ostatní části hlavního řetězce jsou znázorněny tyčkou.

37 Chemické databáze - databáze proteinů Existují následující typy databází proteinů: Databáze primárních struktur: –Příklady: PIR, MIPS, SwissProt, TeEMBL, NRL-3D Komplexní databáze primárních struktur: –Spojují více primárních zdrojů, využívají specificku množinu vyhledávacích kritérií. (Například vyhledávání proteinů, obsahujících určitý strukturní vzor.) –Příklady: NRDB, OWL, MIPSX, SwisProt+TrEMBL

38 Chemické databáze - databáze proteinů Databáze sekundárních struktur: –Obsahují informace, odvozené z primárních sekvencí –Tyto informace jsou nejčastěji reprezentovány v abstraktní formě: regulární výrazy, bloky, speciální chemické struktury (např. fingerprints) –Příklady: PROSITE, PRINTS, BLOCKS, PROFILES, PFAM, IDENTITY Komplexní databáze sekundárních struktur: –Analogicky jako komplexní databáze primárních struktur. –Příklad: Interpro

39 Chemické databáze - databáze proteinů Databáze terciálních struktur (geometrií): –Obsahují prostorové souřadnice daného proteinu (nejčastěji ve formátu PDB) –Příklad: PDB (Protein Data Bank), PDBsum

40 Chemické databáze - databáze nukleových kyselin Nukleová kyselina - schéma:

41 Chemické databáze - databáze nukleových kyselin Nukleosid - základní jednotka nukleové kyseliny:

42 Chemické databáze - databáze nukleových kyselin Báze DNA: Cukr DNA - deoxyribosa: Báze RNA (místo T): Cukr RNA - ribosa:

43 Poznámka: Geometrie nukleových kyselin - modely molekuly I Drátový model: Tyčinkový model:

44 Poznámka: Geometrie nukleových kyselin - modely molekuly II Tyčinky a kuličky:Kalotový model:Páskový model:

45 Chemické databáze - databáze nukleových kyselin Existují následující typy databází nukleových kyselin: Databáze primárních struktur: –Příklady: EMBL, DDBJ, GenBank, dbEST Speciální DNA databáze: –Obsahují druhově specifické DNA, nebo DNA, získané pouze určitým postupem –Příklady: SGD, UniGene, TDB, ACeDB

46 Chemické databáze - úkoly Pomocí programu Rasmol si vizualizujte molekulu DNA a hemoglobinu a vyzkoušejte si použití různých modelů molekuly. V databázi anorganických látek najděte informace o minerálu apatitu (anglicky apatite :-) V databázi organických látek najděte informace o alkaloidu morphinu (anglicky to určitě znáte :-) V databázi PIR najděte informace o proteinu albuminu. V databázi PDB najděte informace o jedu mamby zelené (jed = venom :-). Stáhněte si soubor s geometrií proteinu (PDB soubor), tvořícího daný jed a prohlédněte si ho v nějakém vizualizačním programu. V databázi DDBJ najděte libovolnou DNA začínající bazemi: CACCCTCTCTTCACTGGAAA a prohlédněte si její primární strukturu


Stáhnout ppt "Vhled do praxe I Kdy: 29.10. 2003 –1. skupina (příjmení A - M): 16:00 - 17:40 –2. skupina (příjmení N - Z): 18:00 - 19:40 Kde: –Přírodovědecká fakulta,"

Podobné prezentace


Reklamy Google