Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

FORENSNÍ TESTOVÁNÍ ZVÍŘECÍ DNA Hlavní důvody: zvířecí materiál je stopou z místa trestného činu zvíře napadlo člověka poškozování životního prostředí (např.

Podobné prezentace


Prezentace na téma: "FORENSNÍ TESTOVÁNÍ ZVÍŘECÍ DNA Hlavní důvody: zvířecí materiál je stopou z místa trestného činu zvíře napadlo člověka poškozování životního prostředí (např."— Transkript prezentace:

1 FORENSNÍ TESTOVÁNÍ ZVÍŘECÍ DNA Hlavní důvody: zvířecí materiál je stopou z místa trestného činu zvíře napadlo člověka poškozování životního prostředí (např. lov vzácných savců) ilegální obchod s ohroženými druhy zemědělská a chovatelská kriminalita (podvody) hospodářská kriminalita (podvody) podvody při dostizích veterinárně hygienická zkoumání a potravinářská kriminalita bioarcheologie …

2 FORENSNÍ TESTOVÁNÍ ZVÍŘECÍ DNA Požadujeme: individuální identifikaci jedince identifikaci druhu, poddruhu, variety, plemene

3 ZVÍŘECÍ MATERIÁL JAKO STOPA kočky psi domácí hlodavci domácí ptáci ostatní domácí zvířata nejčastější stopou jsou deriváty kůže

4 IZOLACE DNA Z DERIVÁTŮ KŮŽE lze užít stejné kity jako pro izolaci z lidského trichologického materiálu (např. Tissue & Hair Kit – Promega) výtěžnost DNA je obdobná jako u lidského trichologického materiálu, obsah jaderné DNA ve stvolu chlupu a v paprscích pera je velmi nízký

5 IZOLACE DNA Z DALŠÍCH TYPŮ MATERIÁLU lze užít stejné kity jako pro izolaci z lidského biologického materiálu jako srovnávací vzorek se obvykle používá bukální stěr nebo vzorek krve

6 NEJTESTOVANĚJŠÍMI DRUHY JSOU KOČKY A PSI… …BUDEME SE JIMI TEDY ZABÝVAT BLÍŽE

7 ANIMALIA Chordata Mammalia Carnivora Canidae Canis Canis lupus Canis lupus familiaris Felidae Felis Felis sylvestris Felis sylvestris catus syn. F. s. domesticus

8 KOČKA DOMÁCÍ – Felis catus Carnivora Felidae synantropní živočich – synantropie doložena nejméně 6-8,000 let jedná se o domestikovanou formu kočky divoké - Felis sylvestris v současnosti jen v USA kolem milionů řádně registrovaných jedinců! oblast mediteránu (Středomoří) -        

9 KOČKA DOMÁCÍ – Felis catus 18 párů autozómů XY gonozómy 22 párů autozómů XY gonozómy

10 KOČKA DOMÁCÍ – Felis catus studium kočičího genomu pobíhá především v posledních 15ti letech individuální identifikace je možná v posledních cca 10 letech – předtím chyběly druhově specifické singl-lokusové próby, kočičí genetické databáze, kočičí genetické mapy

11 KOČKA DOMÁCÍ – Felis catus mnoho desítek ras vznikly šlechtěním na základě vzhledového fenotypového projevu genů

12 KOČKA DOMÁCÍ – Felis catus „stará“ plemena původem z JV Asie (Barmská kočka, Bombajská kočka, Havanská hnědá, Birman, Orientální krátkosrstá, Kalifornská krátkosrstá a Siamská) jsou velmi dobře geneticky definována Egyptská Mau a Abbyssinian mají ukázkový monofyletický původ u většiny dalších plemen nelze nalézt významné rozdíly na úrovni genetických markerů – jsou příliš „mladá“

13 KOČKA DOMÁCÍ – Felis catus TESTOVÁNÍ POHLAVÍ nepoužívá se amelogenin, ale lokus v SRY genu

14 KOČKA DOMÁCÍ – Felis catus autozomální STR lokusy v rámci celého genomu požadavky na kandidátní lokusy pro identifikaci: charakteristický repetitivní motiv vysoká heterozygotnost mendelovská dědičnost vazebná nezávislost s ostatními lokusy snadná a robustní amplifikace druhová specifita

15 KOČKA DOMÁCÍ – Felis catus RMP

16 KOČKA DOMÁCÍ – Felis catus Menotti-Raymond et al. – Laboratory of Genomic Diversity, National Cancer Institute at Frederick

17 KOČKA DOMÁCÍ – Felis catus Menotti-Raymond et al. – Laboratory of Genomic Diversity, National Cancer Institute at Frederick bleed-through

18 KOČKA DOMÁCÍ – Felis catus MEOWPLEX - Promega kit je stejný jako to co použili Menotti-Raymond et al. anoncován už 2002, ale není v prodeji!

19 KOČKA DOMÁCÍ – Felis catus aktuálně nejlepší design (11plex+SRY) lze najít na J Forensic Sci, Sept. 2005, Vol.50, No. 5 Menotti-Raymond et al.: An STR Forensic Typing System for Genetic Individualization of Domestic Cat (Felis catus) Samples on-line: RMP: 5,3E-08

20 KOČKA DOMÁCÍ – Felis catus identifikovat individuálně jedince identifikovat „stará“ plemena identifikovat „nová“ plemena Umíme: Neumíme:

21 PES DOMÁCÍ – Canis lupus familiaris Carnivora Canidae synantropní živočich – synantropie mnohem starší než kočičí, odhaduje se až 100,000 let vyvinul se z vlka (Canis lupus), není úplně jasné zda docházelo i k přikřižování šakala (Canis aureus) – dle nDNA/mtDNA asi jen vzácné páření samic vlka se šakalem

22 PES DOMÁCÍ – Canis familiaris 38 párů autozómů XY gonozómy 22 párů autozómů XY gonozómy

23 PES DOMÁCÍ – Canis lupus familiaris mnoho desítek ras vznikly šlechtěním na základě vlastnostního fenotypového projevu (mnoho genů!) rasy šlechtěné na základě vzhledového fenotypového projevu až posledních 300 let

24 PES DOMÁCÍ – Canis lupus familiaris StockMarks® for Dogs Genotyping Canine I Kit StockMarks® for Dogs Genotyping Canine II Kit produkt Applied Biosystems staženy z trhu podobně jako MeowPlex…

25 PES DOMÁCÍ – Canis lupus familiaris J Forensic Sci, March. 2005, Vol.50, No. 2 Halverson et al.: A PCR Multiplex and Database for Forensic DNA Identification of Dogs on-line: intralokusová HWE ? ne! interlokusová HWE? ano!

26 PES DOMÁCÍ – Canis lupus familiaris

27

28

29 samozřejmě se testují i další druhy… StockMarks® for Cattle Genotyping Kit StockMarks® for Horses Genotyping Equine Kit …

30 IDENTIFIKACE DRUHŮ zejména u kriminality související s poškozováním životního prostředí nejčastěji: cytochtom b na mtDNA

31 Convention on the International Trade in Endangered Species založena 1973 (21 států) v současnosti 166 států členství je dobrovolné, ale členové vázáni pravidly a mohou být vyloučeni CITES

32 28,000 rostlinných druhů 5,000 živočišných druhů Nejsledovanější : nosorožec, panda, velryby, orchideje, láčkovky, bezobratlí Obchod s těmito druhy je ilegální a proto je často předmětem forenzního zkoumání CITES

33 Role forensní laboratoře Identifikace druhu –prokázat že produkt je z ohroženého druhu Individuální identifikace –prokázat spojení produktu s konkrétním organismem

34 DNA lokusy k testování druhů Test musí mít dostastečnou mezidruhovou variaci, tedy: musí umět rozlišit blízce příbuzné druhy Test musí mít malou vnitrodruhovou variaci, tedy: musí poskytovat pozitivní výsledek u všech příslušníků druhu Test musí umět pracovat s DNA-chudými a poškozenými vzorky kromě mtDNA toto splňuje jen pár lokusů

35 mezidruhová shoda mtDNA

36 cytochom B splňuje všechny podmínky v taxonomii nejpoužívanější 1140 bp (=380 amino) EMBL DNA Database (www.ebi.ac.uk) GenBank® (www.ncbi.nih.gov) aktuálně více než 32 milionů sekvencí v těchto dtb.

37 rozdíly v cytochrom B genu (bp) vlkpesliškakočka pes4 liška kočka člověk

38 Amplifikace cytochromu b GluThrCytochromeb L14724 H ATG L Primer H Primer amplifikací mezi H a L primerem vzniká 425 bp produkt L & H sekvence jsou u savců mezidruhově konzervativní

39 rozdíly v cytochrom B genu Dog CACGAAACCGGATCCAACAACCCTTCAGGAATCACATCAGACTCAGACAAAATTCCATTT 660 Cow CACGAAACAGGCTCCAACAACCCAACAGGAATTTCCTCAGACGTAGACAAAATCCCATTC 660 Cat CATGAAACAGGATCTAACAACCCCTCAGGAATTACATCCGATTCAGACAAAATCCCATTC 660 Human CACGAAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTC 660

40 rozdíly v cytochrom B genu


Stáhnout ppt "FORENSNÍ TESTOVÁNÍ ZVÍŘECÍ DNA Hlavní důvody: zvířecí materiál je stopou z místa trestného činu zvíře napadlo člověka poškozování životního prostředí (např."

Podobné prezentace


Reklamy Google