Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

KLONOVÁNÍ a GENOVÉ INŽENÝRSTVÍ. 1)úvodní přednáška 2)PCR techniky 3)mutageneze in vitro 4)cDNA a genomové knihovny 5)sekvencování genomů 6)transgenoze.

Podobné prezentace


Prezentace na téma: "KLONOVÁNÍ a GENOVÉ INŽENÝRSTVÍ. 1)úvodní přednáška 2)PCR techniky 3)mutageneze in vitro 4)cDNA a genomové knihovny 5)sekvencování genomů 6)transgenoze."— Transkript prezentace:

1 KLONOVÁNÍ a GENOVÉ INŽENÝRSTVÍ

2 1)úvodní přednáška 2)PCR techniky 3)mutageneze in vitro 4)cDNA a genomové knihovny 5)sekvencování genomů 6)transgenoze rostlin 7)genové čipy 8)transgenoze živočichů 9)genová terapie 10) klonovací strategie a expresní systémy 11) seminář – nástroje molekulární biologie v praxi

3 Získávání bioinformací (dobrovolný seminář) NCBI (National Center for Biological Information) TIGR (The Institute for Genomic Research) SignalP, TargetP (predikce buněčné lokalizace proteinů) BIOEDIT (freeware pro manipulaci s DNA a proteiny) BLAST (basic local alighment and search tool) GENEVESTIGATOR (sledování exprese genů na úrovni celých genomů in silico)

4 LITERATURA Glick R a Pasternak JJ Molecular Biotechnology 3th edition, ASM Press Ltd, Washington, USA, 2003 Sambrook J a kol. Molecular Cloning 1,2,3 3th edition, Cold Spring Harbor Laboratory Press, New York, USA 2001 Rosypal S Úvod do Molekulární Biologie díl čtvrtý třetí vydání, Prof.RNDr. Stanislav Rosypal, DrSc, Brno 2002 Brown TA; překlad Fellner M a kol. Klonování genů a analýza DNA 1 české vydání, Olomouc UP 2007

5 Centralní dogma DNA RNA Protein DNA do DNA  REPLIKACE DNA do RNA  TRANSKRIPCE RNA do Protein  TRANSLACE RNA do DNA  REVERZNÍ TRANSKRIPCE Jeden gen jeden enzym (protein/polypeptid) Fenotyp

6 Centralní dogma (kodující sekvence ORF (open reading frame) a nepřekládané regiony – 5´-UTR, 3´-UTR) 5’ C AAA 3’ 3’ 5’ N Gen 9,200 bp zralá RNA 1,870 bp Protein 386 aa CDS 1158 bp (coding sequence) AAGCTCGACTAGCGCTAGCCTACCTAGCTCTCCCCTTCC

7 Struktura genu Introny a Exony Promotor Enhancer a Silencer Počátek transkripce Transkripční faktory Signální sekvence Introny a Exony Introny a Exony: Kodující sekvence (ORF) mnoha eukaryotických genů je přerušená sekvencí známou jako introny. Introny jsou úseky DNA jejichž transkripty nejsou přítomný ve zralé mRNA. Exony jsou části sekvence přítomné ve zralé mRNA a kodují produkt eukaryotického genu.

8 Místo počátku transkripce: místo kde začíná syntéza mRNA (pozice 0, - 30bp od TATA boxu). Promotor: Oblast genu (5’-konec) upstream od místa počátku transkripce sloužící jako templát pro navázání transkripční jednotky a iniciaci transkripce. Inducibilní promotor – je závislý na přítomnosti induktoru (nízkomolekulární látka). Konstitutivní promotor – nezávislý (provozní „house keeping“ geny). Enhancer: Část sekvence genu která interaguje s transkripčními faktory a tak zvyšuje účinnost transkripce. Je umístěna upstream nebo downstream od kódující sekvence a může být stovky bází daleko od kódující sekvence kterou kontroluje. Silencer: Opak enhanceru. Transkripční faktory: Proteiny interagující se specifickou sekvenci DNA, většinou ovlivňující terciální strukturu DNA a tak regulují transkripční jednotku. Jsou buď aktivátory nebo represory viz výše. Koaktivátory: Proteiny interagující s transkripčními faktory (ale ne s DNA) regulující transkripci. Signální sekvence: kóduje signální peptid, který předurčuje zacílení proteinu na buněčné úrovni a následně se odštěpuje.

9 DNA polymerasy blíže přednáška techniky PCR DNA  DNA

10 DNA  RNA Transkripce (RNA syntéza): přenos informace z DNA do RNA (nestabilní) prostřednictvím enzymu RNA Polymerasy ( DNA-dependentní RNA Polymerasa). Syntéza RNA je komplementární k templátovému DNA duplexu a je identická s netemplátovým vláknem duplexu (5´-3´). Netemplátový řetězec je proto nazýván kódující řetězec a je identický s mRNA s výjimkou záměny U za T. Typy RNA: (1-5%) messenger RNA (mRNA, polyA + RNA). RNA která je přepisována do polypeptidů (1-5%). (90%) ribozomální RNA (rRNA). strukturní složka ribozómů. (90%) (5-10%) transferová RNA (tRNA). přenašeč aminokyselin do místa syntézy proteinu. (5-10%) málá jaderná, jadérková, cytoplazmatická RNA (snRNA/sno/scRNA). sestřih mRNA

11 Postranskripční úpravy mRNA Čepička (capping). modifikovaný guanozin (m 7 G) je přidáván na 5'-konec většiny mRNA. Stabilita mRNA a podílí se na vazbě k ribozomu. Polyadenylace bp dlouhá sekvence polyadenozinu je přidávána na 3'-konec většiny eukaryotické pre-mRNA. PolyA konec není kodován v DNA. Sestřih intronů a exonů. introny jsou vyštěpeny a exony spojeny dohromady ve struktuře zvané spliceozom. Y pyrimidinová báze

12 Postranskripční úpravy mRNA

13 RNA  protein Translace (syntéza proteinů): Translace je proces přeměny informace z RNA do aminokyselinového řetězce (polypeptidu) probíhající v cytoplasmě. Zralá mRNA je transportována do cytoplasmy k ribozomům (mnohdy vázané na endoplasmatickou retikulární síť). Ribozóm se skládá ze strukturní rRNA a 80 různých proteinů, které tvoří malou a velkou podjednotku. Iniciace: Zachycení mRNA a nalezení start kodonu AUG, který koduje methionin. (M je odštěpen během postranslačních úprav nebo společně se signálním peptidem) Elongace: Přidávání různých AK v aktivované formě vázané na tRNA a vytváření peptidové vazby mezi amino a karboxylovou skupinou. Terminace: STOP kodón (UAA, UAG nebo UGA) Posttranslační úpravy: Fosforylace, glykosylace, organelové cílení a odštěpení signálního peptidu, složení do aktivního stavu (vytvoření terciální a kvartérní struktury).

14 Reverzní transkriptasa Reverzní transkripce: Proces vytvoření DNA z RNA templátu za pomocí RNA-dependentní DNA polymerasy – Reverzní transkriptasa (RT). AMVMMLV RT je přítomná pouze v RNA virech avian myeloblastosis virus (AMV), Moloney murine leukemia virus (MMLV), nebo human immunodeficiency virus (HIV). Aplikace: tvorba cDNA (komplementární DNA): přesná DNA kopie mRNA. DNA sekvence proteinu bez přerušení introny. cDNA knihovny RT PCR RNA  DNA

15 Hybridizace Dva řetězce DNA mohou být k sobě komplementární. mRNA syntetizována z genu je identická k jednomu vláknu svého genu a komplementární k druhému vláknu. Komplementární řetězce mohou být odděleny (denaturace) a znovu spojeny (renaturace – hybridizace) na různém stupni specifity, mohou vznikat hybridní formace DNA-DNA, DNA-RNA, nebo RNA- RNA. Methody využívající těchto vlastnosti: Southern blot: Hybridizace DNA na DNA (v pevné fázi) Northern blot: Hybridizace DNA na RNA (v pevné fázi) RNAse protection assay: Hybridizace RNA na RNA (v roztoku) In situ hybridizace DNA-DNA nebo DNA-RNA (ve tkání, či v buňce, např. FISH) izolace mRNA: vazba polyA konce na polyT sekvenci navázanou na pevný matrix. Stringence: podmínky zaručující stupeň specifity (komplementarity)

16 Strigence hybridizace teplota▲ koncentrace soli ▼ Denaturační činidla (formamid) za snížené teploty udržují vysokou strigenci

17 Princip Southern a Northern blotu Hybridizační sondy Hybridizační sondy jsou značené: chemiluminiscenčně BIOTIN detekce AVIDIN-HRP, DIGOXYGENIN fluorescenčně FLUORESCEIN, RHODAMIN radioaktivně dAT 32 P, 3 H Příprava sond: 5´ a 3´koncové značení – nízká citlivost pomocí RANDOM HEXAMERů a DNA polymerasy (Klenowův fragment) PCR nick translace – DNasa I a DNA polymerasa in vitro transkripce (RNA próby) FISH fluorescent in situ hybridization

18 příklad nukleotidu značeného digoxygeninem

19 Příprava hybridizačních sond značení pomocí náhodných hexameruznačení pomocí nick translation (posun jednořetězcového zlomu)

20 RESTRIKČNÍ ENDONUKLEASY (restrikční enzymy II třídy) rozpoznávají specifické sekvence dsDNA a štípou jí ve stejném místě rozpoznávací místo je 4-8 bp dlouhé štípou dlouhé fragmenty dsDNA na kratší štípou vždy znovu opakovatelným způsobem pocházejí především z bakterií ochrana před cizorodou DNA především bakteriofágovou modifikačně-restrikční enzymový systém (RE + specifická modifikační metylasa) Přes 120 rozpoznávacích míst dodnes popsaných více než 800 RE

21  RE mohou na DNA vytvářet TUPÉ nebo LEPIVÉ konce  restrikční sekvence jsou většinou symetrické.  nukleotidy vytvářejí PALINDROM Palindrom: sekvence se čte stejně v obou směrech jak ve 5’  3’ tak ve směru 5’  3’ na komplementárním řetězci. RESTRIKČNÍ MíSTA MAJÍ BOD SYMETRIE TUPÉ KONCE – nespecifické spojení LEPiVÉ KONCE – specifické spojení EcoRI

22 KpnI vs. Asp718 - izoschizomery Existují RE se stejnou restrikční sekvencí lišící se pouze typem vzniklých konců (5´- či 3´- lepivé) KpnI vs. Asp718 - izoschizomery Lepivé konce: každý DNA fragment (jakéhokoli původu) tvoří štěpením stejnou RE dvě jednovláknové identické sekvence (čtené ve směru 5’ - 3’). Kompatibilní konce: BamHI GˇGATCC BglII AˇGATCT

23 dvě odlišné DNA mající stejné rozpoznávací místo pro danou RE se mohou vzájemně spojit v rekombinantní DNA molekulu rekombinantní DNA molekula: rekombinantní DNA molekula: je nová kombinace nukleotidů v DNA která se nevyskytuje volně v přírodě

24 GTAC Působení RE je velmi citlivé na iontovou sílu roztoku a charakter přítomných solí. Pokud nejsou zachovány specifické podmínky pro danou RE ta může mít tzv. star aktivitu STAR AKTIVITA STAR AKTIVITA – nespecifické náhodné štěpení Počet nukleotidů v restrikčním místě dané RE determinuje průměrnou délku fragmentů DNA získaných naštípaním danou RE průměrná vzdálenost mezi restrikčními sekvencemi v DNA = 4 n n = # bází v restrikčním místě Pravděpodobnost že dané restrikční místo bude nalezeno v genomu: 1)4 4 = 256 bp 2)4 6 = 4096 bp 3)4 8 = bp

25 T4 DNA ligasa enzym izolovaný z T4 bakteriofága infikujícího E.coli, katalyzuje tvorbu fosfodiesterové vazby mezi 5´fosfátovou skupinou jednoho a 3´OH skupinou sousedního nukleotidu. reakce vyžaduje energii jednoho ATP používá se ke spojování lepivých i tupých konců dvou restrikčních fragmentů DNA, připojování různých adaptorových sekvencí k DNA a cirkulizaci DNA Reakce se provádí většinou za snížené teploty (15- 16°C) aby se snížila kinetická energie molekul a zabránilo se tak nekomplementárnímu spárování lepivých konců. zápor: nízká aktivita enzymu – dlouhý reakční čas. Další enzymy používané v molekulární biologii: Alkalická fosfatasa Mung Bean nukleasa

26 KLONOVÁNÍ Molekulární klonování: multi-krokový proces který vytvoří kolekci definovaných fragmentů dané DNA pomocí restrikčních endonukleas vektor spojení vybraných DNA fragmentů (většinou jednoho genu) se speciálním nosičem – vektor pomocí T4 DNA ligasy přenos vzniklého konstruktu do živých buněk (často baktérie) DNA KLONY mnohonásobné namnožení vložených DNA fragmentů replikaci v živé buňce – DNA KLONY Buněčné klonování: vytváření geneticky identických buněk (organismů) v živé přírodě přirozené: kolonie baktérii řízkování rostlin jednovaječná dvojčata umělé ►

27 KLONOVACÍ VEKTORY PLASMIDY A)Bakteriální a kvasinkové – PLASMIDY -přirozené součástí bakteriálních buněk nesoucí vlastní genetickou informaci ve formě dsDNA (rezistence k antibiotikům, metabolismus nezvyklých substrátů…) 1-100kb -replikují se nezávisle na baktérii -vlastní plasmidové vektory vznikly úpravou přirozených pBR (Bolivar a Rodriguez) kb menší než je přirozeně se vyskytující v E.coli ori - ori vlastní počátek replikace - rezistence k Amp a Tc - unikátní restrikční místa 1-5 kb - kapacita pro inzertovou DNA 1-5 kb ori MCS multiple cloning site (polylinker) „high copy“ plasmidy kopií v buńce

28 KLONOVACÍ VEKTORY BAKTERIOFÁGY B)Virové - BAKTERIOFÁGY -bakteriální viry s dvouřetězcovou lineární DNA 2-25kb -klonovací kapacita 2-25kb inzertu -mnohonásobné množení v závislosti na hostitelské bakterii BAKTERIOFÁG lambda 49kb Střední část genomu není důležitá pro lytický růst a lze ji nahradit inzertovou DNA snadná manipulace díky cos místům (lepivé konce) na koncích λ DNA, které umožňují její cirkulaci Zacirkuluje se pouze bakteriofág, který má vzdálenost mezi cos místy 37-52kb tvorba cDNA a genomových knihoven cos

29 KOSMIDY C) bakteriálně-virové - KOSMIDY odvozené z plasmidu do kterého byly naklonovány cos místa bakteriofága λ Inzertová DNA je naklonována do lineárního kosmidu a sbalena in vitro virovým mechanismem a infikována do bakterie v bakterii je pak cirkulována a replikuje se dál jako plasmid 47kbmalá velikost cca 5kb – není potřeba infekčních lytických λ proteinů, pouze selekční marker k antibiotiku, velikost inzertové DNA se může pohybovat až k 47kb FASMIDY (phagemid) D) bakteriálně-virové - FASMIDY (phagemid) odvozené od bakteriofága M13 s malou ssDNA (6.4kb), který se po infekci do bakterie replikuje jako kruhovitá dsDNA (plasmid, snadná manipulace, restrikce) infekční fágové částice však opět obsahují pouze ssDNA (vhodný zdroj pro izolaci ssDNA např. pro hybridizaci) do infekčních částic mohou být sbaleny částice až dvakrát větší než je fágová DNA KLONOVACÍ VEKTORY

30

31 YAC umělé kvasinkové chromosomy E) kvasinkové - YAC umělé kvasinkové chromosomy (yeast artificial chromosomes) KYVADLOVÉ VEKTORY KYVADLOVÉ VEKTORY umožňující existenci a replikaci ve dvou rozdílných organismech: pYES bakterie – kvasinka - počátek replikace z přirozeného kvasinkového vektoru 2μ Ti-plazmid bakterie – rostlina viz přednáška transgenoze rostlin KLONOVACÍ VEKTORY patří mezi kyvadlové vektory (shuttle vector) v bakterii jako kruhová dsDNA (plasmid) vedle sekvencí bakteriálního plasmidu obsahují části kvasinkového chromozomu (centromera, počátek replikace,dvě telomery) linearizací se chromozom aktivuje (oddělení telomer od sebe) 2000kbobrovská klonovací kapacita až 2000kb nestabilita a složitá manipulace (protoplasty)

32 KLONOVACÍ VEKTORY BAC umělé bakteriální chromosomy F) bakteriální - BAC umělé bakteriální chromosomy (bacterial artificial chromosomes) Odvozené od E.coli F-plasmidu (fertility plasmid), „low copy“ 1-2 kopie na buńku VÝHODY oproti YAC: -stabilita (cirkulární) -snadná manipulace -potlačení rekombinace Vhodné fragmenty genomické DNA pro ligaci jsou získány pulsní gelovou elektroforesou VELKÝ VÝZNAM PŔI MANIPULACI S CELÝMI GENOMY INVITROGEN

33 Obecný princip molekulárního klonování klonovací vector + DNA obsahující požadovaný gen (izolace) restrikceligacetransformace selekce pomocí selekčních markerů reprodukce a syntéza cílového proteinu izolace

34 Využití molekulárního klonování zemědělství farmaceutika medicína průmysl základní výzkum uchovávání, zmnožení a manipulace s genetickou informací (cDNA a genomové knihovny)uchovávání, zmnožení a manipulace s genetickou informací (cDNA a genomové knihovny) produkce proteinů pro různorodé využitíprodukce proteinů pro různorodé využití vnášení nových či pozměněných genů do organismů (GMO, genová terapie)vnášení nových či pozměněných genů do organismů (GMO, genová terapie)

35 SELEKČNÍ MARKERY geny nesené na klonovacím vektoru, exprimované současně s transgenem, na jejichž fenotypovém projevu lze transformované buňky snadno selektovat ANTIBIOTIKA 1)geny kódující degradaci ANTIBIOTIKA INHIBITORY SYNTÉZY BAKTERIÁLNÍ BUNĚČNÉ STĚNYINHIBITORY SYNTÉZY BAKTERIÁLNÍ BUNĚČNÉ STĚNY AMPICILIN AMPICILIN gen Amp koduje  -laktamasu která štěpí  -laktámový kruh penicilinových antibiotikCEFOTAXIM INHIBITORY SYNTÉZY PROTEINůINHIBITORY SYNTÉZY PROTEINů CHLORAMFENIKOL, KANAMYCIN (vážou se na ribozomální podjednotky) gen Cml kóduje chloramfenikol acyltransferasu gen Kan kóduje aminoglykosid fosfotransferasu AMPICILIN

36 SELEKČNÍ MARKERY ANTIBIOTIKA 1)geny kódující degradaci ANTIBIOTIKA INHIBITORY SYNTÉZY PROTEINůINHIBITORY SYNTÉZY PROTEINů TETRACYKLIN TETRACYKLIN (zabraňuje vazbě aminoacyl tRNA k ribozomu) gen Tet kóduje membránový protein, který aktivně transportuje TC ven z buňky HYGROMYCIN B HYGROMYCIN B (interferuje s velkou ribozomální podjednotkou a zabraňuje elongaci syntetizovaného peptidu) gen způsobující rezistenci hgh kóduje fosforylasu inaktivující toto antibiotikum. PůSOBÍ I NA EUKARYOTICKÉ BUŇKY!!! (selekce transgenních rostlin) INHIBITORY TRANSKRIPCE A REPLIKACEINHIBITORY TRANSKRIPCE A REPLIKACE ACTINOMYCIN D ACTINOMYCIN D (inhibuje transkripci tím, že se váže na specifické úseky DNA) RIFAMPICIN RIFAMPICIN (inhibuje prokaryotní RNA polymerasu, ale i chloroplastovou a mitochondriální, proto je toxicky i pro člověka) ZEOCIN ZEOCIN – glykopeptid izolovaný ze Streptomyces, který štěpí po vstupu do buňky jakoukoliv DNA. Rezistentní gen Sh ble kóduje inhibiční protein (13.6 kDa) tohoto glykopeptidu. koncentrace účinné pro selekci: Baktérie25-50  g/mL Kvasinky  g/mL Savčí buňky  g/mL   ZEOCIN

37 SELEKČNÍ MARKERY NUTRIČNÍ NEDOSTATEČNOST (ztráta autotrofie) 2) geny kódující enzymy narušující NUTRIČNÍ NEDOSTATEČNOST (ztráta autotrofie) - používají se především pro selekci transgenních kvasinek Gen URA3Gen URA3 kóduje enzym orotidin 5´-fosfát dekarboxylasu, enzym metabolické dráhy uracilu LYS2LYS2 kóduje aminoadipát reduktasu (bisyntéza lyzinu) ADE2 LEU2 TRP1ADE2 (C1-tetrahydrofolát syntasa), LEU2 (  - izopropylmalát dehydrogenasa), TRP1 (fosforibozylanthranilát izomerasa) Princip selekce: pro transformaci daného plasmidu se použijí specifické kmeny kvasinek deficientní pro daný gen, selekce se pak provádí na minimálním médiu (bez živin). kmen Saccharomyces cerevisiae INVSc1 Příklad: kmen Saccharomyces cerevisiae INVSc1 genotyp: MATa his3  1 leu2 trp1-289 ura3-52 /MAT his3  1 leu2 trp1-289 ura3-52 fenotyp:His -, Leu -, Trp -, Ura - tzn. že tento kmen je autotrofní na histidin, leucin, tryptofan a uracil a na médiu bez těchto živin neporoste kyvadlový vektor pro transformaci kvasinek 

38 SELEKČNÍ MARKERY blue/white screening test 3) blue/white screening test -pomocný test pro selekci transformovaných bakterií či bakteriofágu  -galaktosidasu -klonovací vektor nese gen lacZ + který kóduje enzym  -galaktosidasu (štěpí laktosu na galaktosu a glukosu) -MCS je umístěn uvnitř tohoto genu, a po vložení inzertu se tento gen stává neaktivní Ampicilin Ampicilin (zabije netransformované bakterie)  X-GAL X-GAL (5-Bromo-4-chloro-3-indolyl b-D-galactopyranoside)  umělý substrát IPTG IPTG (isopropyl-1-thio-  -D-galaktopyranoside)  induktor exprese lacZ genu O O OH HOCH 2 HOHO HO NHNH Br Cl X-GAL galaktosa modré barvivo 

39 lytický a lysogenní cyklus virů

40 struktura lambda bakteriofága

41 SELEKČNÍ MARKERY LAMBDA FIX II VEKTOR LAMBDA FIX II VEKTOR ( bakteriofágový vektor) - selekce se provádí na speciálním kmeni E.coli (lysogenní pro P2 bakteriofága, tzn. že hostitelská buňka je již napadená jiným bakteriofágem) -Pokud má vektor genotyp red/gam+ na daném kmeni neroste je tzv. Sensitivní k P2 interferenci (Spi + fenotyp) -red a gam geny se nacházejí ve střední části (stuffer) a jsou nahrazeny inzertem. Bakteriofág s inzertem je tudiž Spi- a může být vyselektován na P2 lysogenním kmeni lysogenní selekce bakteriofágových vektoru 4) lysogenní selekce bakteriofágových vektoru inzert (genomová knihovna)  12 kb  red/gam+ red/gam- příliš malý nesbalí se do kapsidy


Stáhnout ppt "KLONOVÁNÍ a GENOVÉ INŽENÝRSTVÍ. 1)úvodní přednáška 2)PCR techniky 3)mutageneze in vitro 4)cDNA a genomové knihovny 5)sekvencování genomů 6)transgenoze."

Podobné prezentace


Reklamy Google