Prezentace se nahrává, počkejte prosím

Prezentace se nahrává, počkejte prosím

Syntéza proteinů priony. 8. Molekulární biologie kapitola 13)

Podobné prezentace


Prezentace na téma: "Syntéza proteinů priony. 8. Molekulární biologie kapitola 13)"— Transkript prezentace:

1 Syntéza proteinů priony. 8. Molekulární biologie kapitola 13)

2 Syntéza proteinů TRANSLACE

3 Jetelový list v 2-D zobrazení Tvar písmene L ve 3-D zobrazení tRNA místo pro navázání aminokyseliny (CCA konec) antikodonová smyčka D smyčka T smyčka variabilní smyčka akceptorový stonek

4 Struktura tRNA / video

5 D-smyčka = dihydrouracil T-smyčka = T  C = thymin a pseudouracil tRNA obsahuje báze modifikované až po transkripci RNA dihydrouracil uracil pseudouracil metylace thymin Důležité pro sestavení terciální struktury tRNA a pro vazbu ribozomu uracil

6 Báze modifikované v tRNA

7 Antikodon v tRNA rozeznává kodon v mRNA 1 tRNA = 1 aminokyselina párování přes vodíkové můstky

8 Genetický kód 64 kodonů 20 aminokyselin AUG = methionine (nebo GUG-valin): start kodon UAA, UAG, UGA: stop kodon Existuje více tRNA pro stejnou aminokyselinu, minimálně 31 rozdílných tRNA v každé buňce Proč jich není 64-3, tedy 61?

9 Některé tRNA rozeznávají více než jeden kodon 1. nukleotid antikodou a 3. nukleotid kodonu nepárují zcela přesně ‘Wobbling' rules

10 Univerzální čtecí kód neplatí vždycky výjimky v mitochondriích a některých mikroorganizmech

11 Nabíjení tRNA aminokyselinou 1. formace aminoacyl AMP 2. přenos na tRNA aminoacyl-AMP aminoacyl-tRNA aminoacyl tRNA syntetázy 1 AK = 1 aminoacyl tRNA syntetáza, tedy 20 různých syntetáz v buňce rozpoznávají antikodon a akceptorový stonek, vážou ATP a AK AK + ATP = aminoacyl AMP + PPi aminoacyl AMP + tRNA = aminoacyl tRNA + AMP

12 Nabíjení tRNA / video

13 RIBOZÓM – komplex RNA a proteinů S (Swedberg) – sedimentační koeficient 2/3 RNA, 1/3 proteiny (kolem padesáti) rRNA

14 Velká podjednotka (hlavně 23S) funguje jako peptidyl transferáza = má katalytickou funkci RIBOZYM

15 gen promotor 5’UTR 3’UTR ORF ATG mRNA protein Pouze část mRNA se translatuje do proteinu Oblasti v 5’UTR a 3’UTR pro regulaci stability mRNA nebo účinnosti translace

16 Genetický kód lze číst třemi způsoby, podle toho, kde je začátek! +1 frameshift +2 frameshift Genetická informace v každém čtecím rámci je jiná RŮZNÉ ČTECÍ RÁMCE V RNA STEJNÁ SEKVENCE Různé čtecí rámce (ORFy)

17 Kde najít na mRNA počátek translace? …CAAAUGUAUGCAUGCCAAAGGAGGCAUGUAAGGA… Každá mRNA obsahuje mnoho potenciálních AUG start kodonů První AUG za místem nasednutí ribozomu bude bráno jako počátek translace.

18 Místo nasednutí ribozomu Shine Dalgarno sekvence na mRNA (aneb ribosome binding site = RBS) anti Shine Dalgarno sekvence na 16S rRNA (malá podjednotka) PROKARYOTA Přesné párování - vysoká účinnost translace Nepřesné párování – nižší účinnost translace

19 Iniciátorová tRNA prokaryota – N-formyl-methionin eukaryota - methionin po translaci často odštípnut Rozpoznává start kodon: • ve většine případů AUG • zřídka GUG, ale i zde kóduje Met (not Val) (u proteinů s velice nízkou expresí) • váže se rovnou do P-místa ribozomu (ne A)

20 Sestavení iniciačního komplexu 1.mRNA naváže samostatnou malou podjednotku na SD sekvenci 2. navázání iniciátorové tRNA do AUG PROKARYOTA 3. navázání iniciačních faktorů IF2, IF1 – stabilizují fMet-tRNA IF3 – rozpoznává AUG a antikodon v fMet-tRNA a brání také předčasnému navázání velké podjednotky 4. Uvolnění IF3, nasednutí velké podjednotky, uvolnění IF1 a IF2 za spotřeby GTP 30S iniciační komplex 70S iniciační komplex

21 akceptorové místo (A) peptidové místo (P) místo výstupu (E, exit)

22 Figure 6-64 Molecular Biology of the Cell (© Garland Science 2008) 3D struktura ribozomu (prokaryotního 70S) Rozhraní mezi malou + velkou podjednotkou tvoří vazebná místa pro mRNA a pro tRNA

23 Prokaryotní inciace/ video bosome_assembly_translation_complexes.php

24 Elongace • 23S rRNA velké podjednotky katalyzuje peptidyl transferázovou reakci – spojení předchozího peptidického řetězce s novou aminkyselinou na tRNA v A místě • tRNA přináší novou aminokyselinu, váže se do akceptorového místa za pomoci EF-T • tRNA s novým peptidem se nakloní směrem k P, díky EF-G (elongation factor G) • translokace – mRNA se posune podél ribozomu, tRNA se posune z A do P a z P do E • odpadne EF-G, umožní odpadnutí tRNA z E PROKARYOTA Vždy maximálně 2 tRNA vázány současně na jednom ribozomu

25 Terminace • stop kodon na mRNA: UAA, UAG, UGA • neexistuje žádná tRNA, ale jsou rozpoznávány uvolňovacími faktory (RF1 nebo RF2, release factors) • peptid je odštěpen peptidyltransferázovou aktivitou ribozomu, tRNA se posune do E místa a odpadne • RRF (ribosome recycling factor) uvolní velkou podjednotku • uvolnění malé podjednotky a mRNA PROKARYOTA

26 Prokaryotní translace / video

27 Shine Dalgarno sekvence Shine Dalgarno sekvence Shine Dalgarno sekvence Prokaryotní mRNA je polycistronní, obsahuje více ORF Každý ORF musí mít svou SD sekvenci, kde nasedne ribozom. Trypanosoma – jediný Eukaryot s polycistronními transkripty

28 U prokaryot probíhá transkripce a translace současně U eukaryot transkripce v jádře (navíc sestřih), ale translace na ribozomech v endoplazmatickém retikulu nebo v cytoplazmě Bakteriální polyzom není cirkulární.

29 Ribozomy jdou přímo napojeny na RNA polymerázu přes NusEG komplex

30 Polyzom (polyribozom) mRNA pokrytá více ribozomy najednou, přibližně 100 bazí od sebe

31 Polyzom eukaryotní buňky je cirkulární Poly(A) vazebné proteiny vážou eIF4 na čepičce mRNA elektronový snímek

32 Problém pozastavených ribozomů (stalled ribosomes) • mRNA neobsahující STOP kodon budou akumulovat ribozomy • ribozom se uvolní z mRNA pouze pokud se navážou release faktory (RF1 a RF2) tmRNA • vypadá trochu jako tRNA (ale bez antikodonu) a trochu jako mRNA • jako tRNA váže aminokyselinu (alanin) • pokud najde pozastavený ribozom, naváže se vedle defektní mRNA a slouží jako templát pro translaci • translatuje se 11 aminokyselin a STOP kodon = značka pro degradaci tohoto proteinu (proteasomem) Eukaryota – cirkulární polysom, problem odpadá Místo toho nonsense mediated decay mRNA s predcasnými stop kodony PROKARYOTA

33 ROZDÍLY EUKARYOTNÍ TRANSLACE VIDEO:

34 polyA binding protein eIF4E,G,A,B Komplex vázající čepičku 43S preiniciační komplex Skenování mRNA do prvního AUG za spotřeby ATP Pokud AUG příliš vzdálená konsensu GCCRCCAUGG, první AUG nemusí být rozpoznáno EUKARYOTA VIDEO: •Figure •Assembly of the Eukaryotic Initiation Complex •A) The cap-binding complex includes poly(A)-binding protein (PABP), eIF4A, eIF4B, eIF4E, and eIF4G, which is in an unphosphorylated state when unbound to mRNA. ATP transfers phosphates to the complex to make it competent for binding the mRNA. B) The 43S initiation complex forms bringing the small ribosomal subunit together with the tRNA i met. This complex uses GTP to attach the tRNA to the 40S subunit via eIF2. In addition, initiation factors eIF1, eIF1A, eIF3, eIF5, and eIF2B guide and make the complex competent to bind to the 5’-UTR of mRNA. C) The mRNA is recognized by the cap-binding complex via the connections between eIF4E and PABP which bind the 5’ and 3’ ends of the mRNA, respectively. These two connections cause the rest of the mRNA to loop out. When this is established, then the 43S pre- initiation complex can attach and start scanning for the first AUG. After pausing at the first AUG, then the 50S subunit of the ribosome can bind and initiate translation. 1. Sestavení komplexu vázající čepičku a polyA konec 2. Sestavení preiniciačního komplexu s tRNA a malou podjednotkou ribosomu, za pomoci eIF2 3. Vazba preiniciačního komplexu na komplex vázající čepičku, skenování k prvnímu AUG

35 5. nasednutí velké podjednotky 4. odpoutání eIF1,2,3,5 6. počátek elongace (velice podobná prokaryotům) EUKARYOTA

36 Terminace translace  místo dvou uvolňovacích faktorů (RF1 a 2) rozeznává eRF1 všechny tři kodony  terminace vyžaduje GTP (hydrolyzovaný pomocí eRF3)  uvolnění velké podjednotky pomocí eIF3, uvolnění malé podjednotky a mRNA I R E S (internal ribosome entry site)  několik výjimek u eukaryot a virů, kde ribozom nasedá přímo uvnitř mRNA, ne na čepičku

37 2/3 obsahu buňky jsou proteiny, velmi energeticky náročné, proto regulace proti plýtvání… PROKARYOTA ribosome modulation factor Při obdobích s pomalým růstem buňky jsou přebytečné ribozomy inaktivovány jejich dimerizací pomocí RMF GLOBÁLNÍ REGULACE TRANSLACE Dimerizace ribozomů

38 Odpověď bakterií na hladovění, tepelný šok nebo jiný stres Stringent response Spuštěny geny pro přežití a virulenci Zastavení exprese většiny genů PROKARYOTA vazba nenabité tRNA (kvůli nedostatku aminokyselin) do A místa syntéza pppGpp RelA proteinem vazba ppGpp na polymerázu, změna specificity její vazby na DNA

39 EUKARYOTA Inaktivace eIF2 Při hladovění se sníží většina translace inaktivací iniciačního faktoru eIF2 iniciace uvolnění eIF2 po iniciaci, jeho recyklace pomocí eIF2B: Vysoká syntéza proteinů Nízká syntéza proteinů Fosforylace eIF2 brání funkci eIF2B a recyklaci eIF2 = eIF2 není k dispozici pro iniciaci translace Forsforylace eIF2 Přednáška 6 Další příklady regulace translace, u specifických transkriptů

40 Selenocystein (Sec) • vyskytuje se vzácně v proteinech prokaryot i eukaryot • tRNA nabitá serinem, ale pak enzymaticky modifikován na selenocystein serin selenocystein • 21. kódovaná aminokyselina

41 • Selenocystein kódován UGA kodonem, který normálně znamená STOP • pokud za UGA kodonem následuje SECIS sekvence (selenocystein insertion sequence), přepíše se jako selenocystein a translace pokračuje SECIS sekvence na mRNA tvoří vlásenku

42 Pyrrolysin (Pyl) • vyskytuje se vzácně v proteinech u Archea • lysin napřed enzymaticky modifikován na pyrrolysin, pak teprve navázán na tRNA • 22. kódovaná aminokyselina • kódován UAG kodonem, který normálně znamená STOP

43 Kolik produktů z jednoho genu? nekódující RNA

44 Figure 6-79 Molecular Biology of the Cell (© Garland Science 2008) Mnoho antibiotik je založeno na inhibici bakteriální (a pouze bakteriální) translace Ačkoliv prokaryotní a eukaryotní ribozomy plní stejnou funkci, nemají úplně stejnou strukturu 30S 50S

45 Table 6-4 Molecular Biology of the Cell (© Garland Science 2008) Inhibitory proteinové syntézy a transkripce

46 Priony (kapitola 21, strana 681) o přirozeně exprimován na povrchu nervových buněk v mozku o glykoprotein s cukernými zbytky, upevněn v membráně díky fosfolipidové kotvě o přirozená funkce neznámá, možná ochrana před oxidativním stresem neuronů (obsahuje Cu) o existuje ve dvou alternativních konformacích: PrP C a PrP Sc o PrPSc je schopný polymerizovat do fibrilárních agregátu, což je pro buňku toxické o PrP protein původcem několika typů prionového onemocnění mozku savců Proteiny schopné měnit konformaci jiných proteinových molekul stejného druhu

47 PrP Sc se chová jako infekční protein Tvoří dimer s přirozeným PrP C a změní jeho konformaci na PrP Sc PrP Sc patologický PrP Sc normální PrP C PRION = infekční agens bez DNA nebo RNA a)spontánní konformační změna (bez změn na DNA); trvá léta, než se PrP Sc akumuluje b)dědičná mutace s predispozicí ke špatné konformaci tvořeného PrP • Creutzfeld-Jacob disease • Gertsmann Straussler Scheinker syndrome • fatal familiar insomnia a)přenos mezi jedinci (stejného či jiného druhu) přenosná spongiformní encefalitida (TSE) = syrové maso, sliny, trus • scrapie – u ovcí a koz • nemoc šílených krav (BSE) – obdoba scrapie u dobytka, přenosné na člověka Vznik prionového onemocnění Priony také u některých hub (kvasinek), ale tam pro buňku prospěšné, adaptace na okolní podmínky

48 molecular-biology/index.php?course_id=3942&lecture_no=9 Video z časopisu Nature, výborné…!!


Stáhnout ppt "Syntéza proteinů priony. 8. Molekulární biologie kapitola 13)"

Podobné prezentace


Reklamy Google